(C) PLOS One
This story was originally published by PLOS One and is unaltered.
. . . . . . . . . .



miR-203 secreted in extracellular vesicles mediates the communication between neural crest and placode cells required for trigeminal ganglia formation [1]

['Yanel E. Bernardi', 'Laboratory Of Developmental Biology', 'Instituto Tecnológico De Chascomús', 'Intech', 'Conicet-Unsam', 'Chascomús', 'Escuela De Bio Y Nanotecnologías', 'Unsam', 'Estefania Sanchez-Vasquez', 'Rocío Belén Márquez']

Date: 2024-07

While interactions between neural crest and placode cells are critical for the proper formation of the trigeminal ganglion, the mechanisms underlying this process remain largely uncharacterized. Here, by using chick embryos, we show that the microRNA (miR)-203, whose epigenetic repression is required for neural crest migration, is reactivated in coalescing and condensing trigeminal ganglion cells. Overexpression of miR-203 induces ectopic coalescence of neural crest cells and increases ganglion size. By employing cell-specific electroporations for either miR-203 sponging or genomic editing using CRISPR/Cas9, we elucidated that neural crest cells serve as the source, while placode cells serve as the site of action for miR-203 in trigeminal ganglion condensation. Demonstrating intercellular communication, overexpression of miR-203 in the neural crest in vitro or in vivo represses an miR-responsive sensor in placode cells. Moreover, neural crest-secreted extracellular vesicles (EVs), visualized using pHluorin-CD63 vector, become incorporated into the cytoplasm of placode cells. Finally, RT-PCR analysis shows that small EVs isolated from condensing trigeminal ganglia are selectively loaded with miR-203. Together, our findings reveal a critical role in vivo for neural crest-placode communication mediated by sEVs and their selective microRNA cargo for proper trigeminal ganglion formation.

Funding: This work was supported by the Agencia Nacional de Promoción Científica y Tecnológica (PICT 2018-1879 to P.H.S-M.) and by the Fogarty International Center of the National Institutes of Health (R21TW011224 to M.E.B. and P.H.S-M.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Copyright: © 2024 Bernardi et al. This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

miRNAs are a class of small noncoding RNAs that regulate gene expression at the posttranscriptional level mostly by binding to the 3′ UTR of target transcripts and fine-tune their expression through degradation and/or translational repression [ 22 , 23 ]. They are known to play important roles in the fine regulation of gene expression during normal development, from gastrulation to complex organ formation. miRNAs specifically regulate epithelial plasticity by promoting both epithelial cell delamination and mesenchymal cell coalescence [ 24 ]. In particular, we have previously shown that miR-203 is epigenetically repressed by DNA methylation in premigratory NC cells, thus allowing the up-regulation of its target genes, Snail2 and Phf12, which are essential for their epithelial-to-mesenchymal transition (EMT) [ 25 , 26 ]. Importantly, we observed that the miR-203 locus is rapidly demethylated during NC migration. At the end of migration, NC cells condense into different derivatives, like the cranial sensory ganglia. Thus, we hypothesized that ganglion condensation may require the reactivation of miR-203. Using the trigeminal ganglion as a model, we show that miR-203 is re-expressed in coalescing and condensed NC cells to regulate trigeminal ganglion assembly. Intriguingly, we find that miR-203 is required for trigeminal ganglion condensation. Further, we find that miR-203-containing sEVs are produced in NC cells, which are then taken up by placode cells in which the miRNA exerts its biological effect. Together, our findings reveal that miR-203 is up-regulated in post-migratory neural crest cells and its transport into placode cells via small EVs is critical for trigeminal ganglion condensation.

In recent years, extracellular vesicles (EVs) have emerged as a novel mode of cell-to-cell communication. EVs are capable of transferring information from a donor cell to a recipient cell, leading to changes in gene expression and cell function [ 12 – 17 ]. EVs are classified in 3 main types based on their size and biogenesis: exosomes (50 to 150 nm in diameter) that arise from multivesicular bodies (MVBs), ectosomes or shedding vesicles derived from the plasma membrane (PM) of cells through direct outward budding (100 to 1,000 nm in diameter), and apoptotic bodies that are released during apoptotic cell death (bigger than 1,000 nm in size, [ 18 ]). In particular, the subset of small EVs (sEVs) have been extensively studied in cancer cells, where exosomes and other EVs have been shown to drive multiple aspects of cancer metastasis, including the promotion of cancer cell motility, invasiveness, and premetastatic niche seeding [ 19 – 21 ]. sEVs contain proteins, RNAs, and the cargo of specific microRNAs (miRNAs) that can be transferred from a donor to a recipient cell, leading to changes in gene expression and cellular function in the receivers [ 12 – 17 ].

NC and placode cells are known to interact extensively; for example, Xenopus NC cells chase placodal cells by Sdf-mediated chemotaxis, and placodal cells are repulsed by a PCP and N-cadherin signaling mechanism [ 10 , 11 ]. Thus, precise cell–cell communication is required to facilitate mixing, proper positioning, aggregation, and differentiation of the forming cranial ganglia [ 6 ]. However, surprisingly little is known about the nature of interactions between NC and placode cells during ganglion formation.

The NC, a population of multipotent cells specified in the dorsal neural tube (NT) of vertebrates embryos, migrates extensively and differentiates into diverse cell types including neurons and glia of the peripheral nervous system [ 3 ]. Placode cells arise from the surface ectoderm [ 4 , 5 ], then ingress or invaginate into the cranial mesenchyme. Placode cells then interact with NC cells during condensation of the cranial ganglia, producing functional ganglia comprised of both neural crest- and placode-derived cells [ 6 – 8 ]. While both NC and placode cells contribute to trigeminal neurons, NC cells are the sole source of peripheral glia [ 7 , 9 ].

Organogenesis requires the coordinated interaction of different cell types. In vertebrates, a good example is the interaction between neural crest (NC) cells and ectodermal placodes, 2 cell types of distinct embryonic origin that both contribute to the formation of cranial ganglia such as the trigeminal ganglion (TG). The TG is the largest ganglion in the head and is responsible for mediating sensation of pain, touch, and temperature in the face as well as innervating the sensory apparatus of the eye muscles and the upper and lower jaws [ 1 , 2 ].

Images were transformed to binary scale and the Fiji area calculation function was utilized to measure the area as marked by Sox10 ISH. The background was considered and subtracted from the whole-mount images of stages HH17-18 heads. Areas of the ganglia in the treated sides were normalized to the control side for each embryo as described [ 33 ].

Neural crest and placode cells were electroporated separately in ovo at stage HH9. After treatment, the embryos were allowed to grow at 37°C and each tissue was dissected. A neural crest explant was placed next to a placodal explant in plates previously treated with fibronectin and containing DMEM medium supplemented with 10% fetal bovine serum and penicillin/streptomycin. The explant pairs were cultured at 37°C in 5% CO 2 overnight. Six co-culture experiments were imaged for 2 h with a Zeiss LSM 980 inverted confocal microscope at 37°C in 5% CO 2 .

RNA was prepared from the trigeminal ganglion and sEV fraction using the RNAqueous-Micro isolation kit (Ambion) following the manufacturer’s instructions, and RNA was treated with amplification-grade DNaseI (Invitrogen). The reverse transcription reaction to obtain the cDNA was performed with the MystiCq microRNA cDNA Synthesis Mix kit (Merck) and amplified by PCR using the following primers (miR-34-5p Fw: 5′-GCC GCT GGC AGT GTC TTA G-3′; miR-203 Fw: 5′-CCG GCG TGA AAT GTT TAG G-3′; and miR-UNI Rev: 5′-GAG GTA TTC GCA CCA GAG GA-3′). On the other side, to assess for the impact of the miR-203 sponge on miR-203 expression, we employed the stem-loop-RT-qPCR method, as detailed in our previous work [ 25 ]. In brief, embryos hemi-electroporated ex ovo with miR-203 and Scramble sponges ( S2 Fig ) were incubated until HH8, followed by the dissection of dorsal NTs. Total RNA extraction was accomplished using the RNAqueous-micro kit (Ambion), and the reverse transcription of specific miRNAs (miR-203 and miR16 utilized as normalization control miRNA) was carried out using SuperScript II (Invitrogen) with stem-loop-miRNA-specific primers (slo-miR-203: 5′-GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACCAAGTG-3′; slo-miR-16: 5′-GTCTCCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGGAGACCAAGTG-3′). Subsequent quantitative PCRs were executed on a 96-well plate qPCR machine (StepOne), employing SYBR green with ROX (Roche).

For preparation of sEVs, trigeminal ganglia were treated with a solution of dispase and trypsin to obtain a single cell suspension. Samples were centrifuged at 10,000 × g for 10 min and the supernatant was recovered to isolate sEVs. Then, the sample was filtered through 0.2 μm filter and then pelleted by centrifugation at 100,000 × g for 90 min to obtain an sEVs enriched fraction. As the protocol of EVs isolation include a filtration step using a 0.2 μm filter, the term sEVs (that include exosome and small size microvesicles) will be used throughout the text. sEVs were resuspended in PBS-DEPC containing a protease inhibitor cocktail (cOmplete ULTRA Tablets, Mini, EASYpack, Sigma). For characterization of particle quality size and abundance of the isolated sEVs nanoparticle tracking analysis methodology (NTA—Nanoparticle Tracking Analysis, Nanosight LM10 (Malvern, United Kingdom)) was used. The samples were read in triplicate for 60 s at 10 frames per second, analyzed using NTA Software (version 2.3). The results were annotated as concentration (particles/ml) and mode size (nm). In addition, a fraction of the sample was reserved for the isolation of small RNA.

Trigeminal ganglia were dissected and collected from approximately 80 to 100 HH17-19 stage embryos for each of the replicates required for the different characterization techniques. For TEM, a group of trigeminal ganglia was fixed in a 4% (v/v) glutaraldehyde solution in 0.1 M (v/v) cacodylate buffer, pH 7.2 to 7.4. Samples were gradually dehydrated with serial solutions of 50%, 70%, 80%, 90%, 95%, 100% acetone and then embedded in epoxyPolybed 8120 resin. Next, ultra-thin sections (approximately 70-nm thick) were harvested on 300 mesh copper grids, stained with 5% uranyl acetate and 1% lead citrate, and observed with a FEI Tecnai G2 Spirit transmission electron microscope, operating at 120 kV. The images were randomly acquired with a CCD camera system (MegaView G2, Olympus, Germany).

Whole embryos were fixed for 15 min in 4% PFA, washed in TBST (500 mM Tris-HCl (pH 7.4), 1.5 M NaCl, 10 mM CaCl 2 , and 0.5% Triton X-100) and blocked in 5% FBS in TBST for 1 h at RT. Embryos were then incubated in mouse anti-Tuj1 (1:250; Covance) and/or mouse anti-HNK1 (1:10; supplied by the Developmental Studies Hybridoma Bank) overnight at 4°C diluted in TBST-FBS. Secondary antibodies were goat anti-mouse IgG2a Alexa Fluor 647 (1:500) and goat anti-mouse IgM Alexa Fluor 568 (1:500) for 1 h at room temperature. After several washes in TBS-T, whole embryos or sections (provided by Lic. Gabriela Carina López from the “Histotechnical Service” at INTECH) were mounted and imaged by using Carl ZEISS Axio observer 7 inverted microscope containing an Axiocam 503 camera and Carl ZEISS ZEN2.3 (blue edition) software.

Embryos were fixed overnight in 4% PFA in PBS at 4°C and then utilized for whole-mount ISH for mRNA [ 32 ] and miRNAs [ 25 ] following the previously published protocols. In both cases, the mRNAs and LNA probes were labeled with digoxigenin (Roche). Hybridized probes were detected using an alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche, 1:2,000) in the presence of NBT/BCIP substrate (Roche). After ISH, some embryos were re-fixed in 4% PFA in PBS, washed, embedded in gelatin, and cryostat sectioned at a thickness of 14 to 16 μm. Embryos were photographed as a whole-mount using a ZEISS SteREO Discovery V20 Stereomicroscope with an Axiocam 512 camera and Carl ZEISS ZEN2 (blue edition) software.

For in ovo electroporation, eggs were incubated horizontally until stage HH8/9 and vectors were injected and electroporated to exclusively target the neural crest or the trigeminal placode cells ( S1 Fig ). After injection on the specific sites, a platinum electrode was placed on each side of the embryo, and the chick embryos were electroporated with 5 pulses of 15 V for 50 ms on and 100 ms off intervals. The electroporated eggs were then sealed with adhesive tape and incubated until the desired stages were reached as described previously [ 28 ]. For ex ovo electroporation, embryos at HH4/5 were injected using pressure system but platinum electrodes were placed vertically across the chick embryos and electroporated with 5 pulses of 5.5 V. Embryos were cultured in 0.5 ml albumen in tissue-culture dishes until the desired stages as previously described [ 29 ]. Embryos were then removed from eggs or dishes, placed in PBS and fixed in 4% PFA and utilized for immunohistochemistry or in situ hybridization protocol. The miR-203 overexpressing, sponge and sensor vectors were described and characterized in our previous publication [ 25 ]. We employed the optimized CRISPR/Cas9 system for chick embryos developed by Gandhi and colleagues [ 30 ] to knockout miR-203. Two gRNAs (gRNA_101: CGCTGGTCAATGGTCCTAAACATTTCAC; gRNA_87: GCCCGGGCCTCGCTGGTCAAG) were designed to target the miR-203 locus. These gRNAs were expressed under the control of the optimized chicken U6.3 promoter. Additionally, we designed a scrambled gRNA to serve as a control. To validate CRISPR-mediated genomic editing at the miR-203 locus and assess the reduction in its expression, we co-electroporated vectors containing the gRNAs (scrambled gRNA on the left side and both miR-203 gRNAs on the right side) with CAGG>nls-Cas9-nls at the gastrula stage. Embryos were then harvested at stage HH8 ( S1B Fig ) and dissected in halves. Small RNAs were isolated for stem-loop RT-qPCR, and genomic DNA was prepared for genotyping. The PCR-amplified miR-203 locus flanking the gRNA target sites (Fw: CCCCAGCGCGAGGACGTT; Rv: CAGCCCTCGATTCGCGCACT) was subjected to heteroduplex mobility assay (HMA PCR). Electrophoresis was performed on a 12% acrylamide gel, followed by staining with ethidium bromide for 15 min. Multiple heteroduplex bands were observed in PCR amplicons from miR-203 gRNA-treated embryos, and a single band obtained in scrambled gRNA-electroporated embryos. Consistent with these findings, a significant reduction in miR-203 expression was evident in embryos treated with miR-203 gRNAs compared to those treated with scrambled gRNA. pHluo_M153R-CD63-mScarlet (a gift from Alissa M. Weaver, Vanderbilt University School of Medicine, Nashville, Tennessee, United States of America, [ 31 ]) was amplified with 2 pairs of primers (pHluo-Fw: 5′-AAA ctc gag GCC ACC ATG GCG GTG GAA GGA G-3′; pHluo-Rev: 5′-AAA gct agc CTA GGA TCC CTT GTA CAG CTC GTC C-3′), digested (XhoI/NheI), and subcloned into the chick overexpressing pCIG vector. The pCIG-mRFP, containing a CAG promoter and a membrane RFP, was utilized to target placode cells in explants co-culture experiments.

Results

miR-203 is expressed in coalescing trigeminal ganglion cells We first examined the expression pattern of miR-203 during the course of cranial NC migration, coalescence and condensation during trigeminal gangliogenesis (see scheme in Fig 1A) by performing in situ hybridization (ISH) analysis at selected developmental stages in chick embryos. miR-203 was previously shown to be present in premigratory NC cells but down-regulated prior to their delamination from the NT [25]. In agreement with this, we noted that mature miR-203, detected using locked nucleic acid-digoxigenin-labeled probes, was absent at HH13 from migrating HNK1 immunoreactive cranial NC cells (Fig 1B and 1B’). However, miR-203 expression was again noticeable at stage HH16 (Fig 1C and 1C’) co-localizing with NC (red arrowheads HNK1+) and placode cells (green arrowheads Tuj1+) when both populations are coalescing at the site of trigeminal ganglion formation. Later at stage HH20 when the ganglion is almost fully condensed, signal was robust, particularly at the center of the lobe where most of the placode cells are residing (Fig 1D and 1D’). Taken together, these data indicate that miR-203 expression is reactivated at the time of NC coalescence and condensation into ganglia, consistent with the intriguing possibility that miR-203 may be required for NC aggregation during trigeminal ganglion formation. PPT PowerPoint slide

PNG larger image

TIFF original image Download: Fig 1. miR-203 expression is activated during trigeminal ganglion formation. (A) Schematic diagrams of a cross-section through the cranial NT illustrating the migration (B, B’) of NC and their coalescence (C, C’) and condensation (D, D’) with placode cells during TG formation in chicken embryos. Scale bars: 100 μm. Transverse section of miR-203 after in situ hybridization using an LNA-DIG-labeled probe followed by immunostaining for HNK1 (neural crest marker in red) and Tuj1 (placodal marker in green) at HH13 (B), HH16 (C), and HH20 (D). Scale bars: 50 μm. While miR-203 is absent from migrating NC cells, its expression reinitiates at the time of ganglion coalescence and remains present in the condensed ganglion. Red and green arrowheads in C’ denoted early coalescing NC and placode cells expressing miR-203, respectively. NC, neural crest; NT, neural tube; TG, trigeminal ganglion. https://doi.org/10.1371/journal.pbio.3002074.g001

Overexpression of miR-203 generates ectopic aggregation of NC cells and a more condensed trigeminal ganglion Given that miR-203 expression is down-regulated at the onset of NC migration and then re-expressed during trigeminal ganglion formation, we asked whether overexpression of miR-203 would accelerate the condensation process. To this end, we generated an overexpression vector containing pre-miR-203 [25] that was electroporated into the right half of the NT at HH9. Embryos were then allowed to develop until HH15-16. The results show that excess miR-203 causes ectopic aggregation of NC cells, as identified by in situ hybridization against Sox10, compared with the control side or embryos treated with empty vector (Control OE) (Fig 2A, black arrowheads). In transverse section, ectopically aggregation of NC cells (Fig 2A’, white arrowheads) and a more densely packed trigeminal ganglion (Fig 2A’, black arrowhead) are evident on the treated side compared to control side (Fig 2B). These results suggest a possible role for miR-203 during trigeminal ganglion condensation. PPT PowerPoint slide

PNG larger image

TIFF original image Download: Fig 2. Overexpression of miR-203 promotes ectopic and premature NC condensation and enhanced aggregation into the trigeminal ganglion. (A) In situ hybridization for Sox10 in HH15-16 embryos unilaterally electroporated (treated side showing green fluorescence in insets) with miR-203 (miR-203 OE) or empty control (Control OE) overexpression vectors. (A’) Cross section of miR-203 OE embryo at the level shown in A (dotted line) reveals an ectopic Sox10+ group of cells (white arrowhead) and a denser TG (black arrowhead) on the treated side. Scale bars: 100 μm. (B) Quantification of embryos showing a phenotype (normal versus affected condensation having ectopic condensation and/or denser TG) on Control and miR-203 OE. Numbers in the graph represent the numbers of analyzed embryos. **P = 0.001 by contingency table followed by a χ2 test. TG, trigeminal ganglion. https://doi.org/10.1371/journal.pbio.3002074.g002

NC is the source of miR-203 transcription, but it places of action are the placode cells Given that miR-203 re-initiates during trigeminal condensation, we next asked whether its loss of function would disrupt proper ganglion formation. To test this possibility, we utilized a “sponge” vector containing repeated miR-203 antisense sequences (miR-203 sponge) previously validated [25] to sequester endogenous miR-203, thereby diminishing its expression (S1 Fig). A sponge vector containing an miR-203 scrambled sequence (Scrambled sponge) was utilized as a control. The NT was electroporated at stages HH8 to target NC cells, but not placodal cells, in one side of the embryo (S2A Fig), and then examined after the ganglia had condensed (HH17-18). To measure the level of condensation, we quantitated the trigeminal ganglia area after ISH for Sox10 in treated versus control side of each embryo. The analysis was conducted using whole-mount images at stages HH17-18. Surprisingly, we failed to detect significant differences in the area of the trigeminal ganglion after the loss of miR-203 in NC cells (Fig 3A). PPT PowerPoint slide

PNG larger image

TIFF original image Download: Fig 3. miR-203 is produced in NC but it places of action are placode cells to secure normal trigeminal ganglion condensation. Electroporation schemes for region-specific transfections (see also S2 Fig). Embryos at HH9 were unilaterally electroporated (treated side showing green fluorescence in insets) in the NT or ectodermal placodes with miR-203 sponge (n = 12) or scrambled sponge (n = 12) plasmids (A, B); or with miR-203 gRNAs + Cas9 (n = 10) or Scrambled gRNAs + Cas9 (NT n = 8; ectodermal placode n = 11) (C, D) (see also S1 Fig and S1 Data). Trigeminal ganglia condensation was analyzed by ISH for Sox10 at HH17-18. Scale bars: 100 μm. Scatter plots represent the quantification of trigeminal ganglia areas (treated side versus control side). ****P < 0.0001, **P = 0.0085 by two-tailed unpaired t test. ns, non-significant differences. Values are means ± SD. NC, neural crest; NT, neural tube. https://doi.org/10.1371/journal.pbio.3002074.g003 The trigeminal ganglion has a dual origin from both NC and ectodermal placodal cells. Therefore, we next explored the possible functional role of miR-203 in the trigeminal placodes, but not affecting NC cells, by electroporating the right placodal ectoderm at HH9 (S2B Fig) with the miR-203 or scrambled sponge plasmids. Intriguingly, the miR-203 sponge resulted in trigeminal ganglia that displayed a more loosely organized and less aggregated morphology than those in the non-injected side or observed in control embryos (Fig 3B, black arrowhead). This result is consistent with a significant reduction in the ganglia-occupied area in embryos treated with the miR-203 sponge compared to those treated with scrambled sponge. Our findings raise the intriguing possibility that miR-203 is produced in the neural crest (donor cell) but exerts its biological effect in the placode cells (recipient cell). To demonstrate this, we now employed CRISPR/Cas9 system to genomic editing the miR-203 locus and reduce its expression (S1B Fig). Interestingly, the electroporation of miR-203 gRNAs or scrambled gRNAs in placode cells resulted in normal trigeminal ganglia formation (Fig 3D). However, the electroporation of miR-203 gRNAs in NC resulted in a less aggregated morphology resulting in a significant reduction in the ganglia-occupied area compared to the non-electroporated side of the same embryos and with those treated with scrambled gRNA (Fig 3C, black arrowhead). Taking together, these results are consistent with the putative role of placode cells as crucial mediators of NC condensation [34], thus emphasizing the importance of cellular communication between the NC and placode cells to ensure correct aggregation in time and space to form the trigeminal ganglion.

miR-203 produced in NC cells regulates translation in recipient placode cells To determine whether miR-203 produced in NC cells can reach placode cells to exert a biological effect, we designed an experiment in which we drove overexpression of miR-203 and cytoplasmic EGFP in the NC cells by electroporation into the premigratory NC. In the same embryos, we electroporated the trigeminal placode in the ectoderm with a dual-colored sensor vector. This vector expresses both nuclear d4EGFPn and mRFPn, but the first containing 2 mature miR-203 recognition sites such that the miR-203, but not other miRNA, can bind and affect only d4EGFPn translation (S4 Fig) [25]. Embryos were electroporated at HH9- with the 2 vectors and allowed to grow until HH17 (see scheme in Fig 6A). Transverse sections through the embryos were then immunostained for Tuj1 to identify the trigeminal ganglion cells (Fig 6B). Although some of the placode cells reaching the condensing area were EGFP+/RFP+ (white arrowhead), some cells within close proximity to the NC (black arrowhead) were only RFP+ (dotted circles) (Figs 6B’ and S5A). This reduced EGFP expression is not visible in the non-migrating ectodermal cells where all the cells co-express both EGFP and RFP cells (white arrowheads in Fig 6B). Importantly, embryos overexpression miR-203 displayed a significant reduction compared with controls when the EGFP/RFP fluorescence intensity ratios were quantified on placode cells (Fig 6D). PPT PowerPoint slide

PNG larger image

TIFF original image Download: Fig 6. miR-203 generated in NC cells inhibits a sensor target electroporated in placode cells both in vivo and ex vivo. (A) Scheme of chick embryo with NT electroporated with miR-203 or empty control overexpressing vectors (with cytoplasmic EGFP) and placode cells electroporated with a dual-colored sensor vector (pSdmiR-203) containing 2 copies of complementary sequences to the mature miR-203. pCAG, Chick β-actin promoter; d4EGFPn nuclear-localized destabilized EGFP with a half-life of 4 h; mRFPn, nuclear-localized monomeric red fluorescent protein. Box of the condensing trigeminal ganglion indicates area of enlarged inset exemplifying the transfer of miR-203 from NC (green) to placode cells (orange because of the expression of both EGFP and RFP), thus affecting the EGFP translation (red cell). (B) Transverse section of HH17 embryos immunostained for Tuj1 (magenta), to identify the trigeminal ganglia with coalescing NC (electroporated with miR-203 OE vector) and placode (electroporated with the dual-colored sensor vector; see white arrowheads) cells. (B’) Zoom of box in B identifying migratory NC cells with cytoplasmic EGFP+ (black arrowhead) and placode cells with nuclear EGFP+/RFP+ (white arrowhead) or only RFP+ (dotted circles). Scale bar: 100 μm. See also S5A Fig for DAPI staining. (C) Time-lapse of co-cultured placode ectodermal cells (electroporated with the dual-colored sensor vector) and dorsal NT (electroporated with miR-203 OE) explants. Placodal cells (PC1-6) interact with NC cells (NC1-2) where the EGFP channel was pseudocolored (red>white>blue) to visualize the EGFP decay in placode cells over time. See also S5B Fig for control and S7 Movie. (D) Scatter plot from in vivo experiments analyzing the EGFP/RFP intensity for individual placode cells reaching the condensing area at HH17 from miR-203 OE or Control electroporated embryos (cells counted in 2–5 sections per embryo, n = 4 embryos from 2 independent electroporations; see S1 Data). ****P < 0.0001 calculated using unpaired Student’s t test. Values are means ± SD. (E) Scatter plot from ex vivo co-cultured experiment analyzing the EGFP/RFP normalized intensity for individual placode cells interacting with NC cells from miR-203 OE or Control electroporated embryos (100 cells, n = 4 co-cultured explants for each treatment from 2 independent experiments; see S1 Data). ****P < 0.0001 calculated using unpaired Student’s t test. Values are means ± SD. NC, neural crest; NT, neural tube. https://doi.org/10.1371/journal.pbio.3002074.g006 A similar experiment to that shown in Fig 5A was performed where separate embryos were electroporated either with miR-203 or control overexpression vectors in the NT, and the dual-sensor vector was electroporated in the trigeminal placode. Explants from both dorsal NT and ectodermal placode were co-cultured ex vivo until migratory cells from both populations were in contact. LUT pseudocolored cells for EGFP intensity (RED>WHITE>BLUE) were analyzed by time-lapse demonstrating that placode cells (with nuclear EGFP+/RFP+) lose EGFP intensity over time when they are in close proximity to the NC cells overexpressing miR-203 (Fig 6C and S7 Movie). The decrease in EGFP intensity was not observed in control explants, where the NC cells were electroporated with an empty vector (S5B Fig). In addition, EGFP/RFP intensity ratios in placode cells co-cultured with miR-203 overexpressing NC cells were quantified and showed a significant decrease compared with controls (Fig 6E). Taken together, our in vivo and co-cultured explant results demonstrate that miR-203 produced in the NC reaches and suppresses translation in placode cells, thus supporting the idea that miRNAs may act as intercellular signals mediating proper neural crest–placode communication.

[END]
---
[1] Url: https://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.3002074

Published and (C) by PLOS One
Content appears here under this condition or license: Creative Commons - Attribution BY 4.0.

via Magical.Fish Gopher News Feeds:
gopher://magical.fish/1/feeds/news/plosone/

You are viewing proxied material from magical.fish. The copyright of proxied material belongs to its original authors. Any comments or complaints in relation to proxied material should be directed to the original authors of the content concerned. Please see the disclaimer for more details.