(C) PLOS One
This story was originally published by PLOS One and is unaltered.
. . . . . . . . . .



Alkenyl oxindole is a novel PROTAC moiety that recruits the CRL4DCAF11 E3 ubiquitin ligase complex for targeted protein degradation [1]

['Ying Wang', 'School Of Pharmacy', 'Shenzhen University Medical School', 'Shenzhen University', 'Shenzhen', 'Tianzi Wei', 'Key University Laboratory Of Metabolism', 'Health Of Guangdong', 'Department Of Medical Neuroscience', 'School Of Medicine']

Date: 2024-05

Abstract Alkenyl oxindoles have been characterized as autophagosome-tethering compounds (ATTECs), which can target mutant huntingtin protein (mHTT) for lysosomal degradation. In order to expand the application of alkenyl oxindoles for targeted protein degradation, we designed and synthesized a series of heterobifunctional compounds by conjugating different alkenyl oxindoles with bromodomain-containing protein 4 (BRD4) inhibitor JQ1. Through structure-activity relationship study, we successfully developed JQ1-alkenyl oxindole conjugates that potently degrade BRD4. Unexpectedly, we found that these molecules degrade BRD4 through the ubiquitin-proteasome system, rather than the autophagy-lysosomal pathway. Using pooled CRISPR interference (CRISPRi) screening, we revealed that JQ1-alkenyl oxindole conjugates recruit the E3 ubiquitin ligase complex CRL4DCAF11 for substrate degradation. Furthermore, we validated the most potent heterobifunctional molecule HL435 as a promising drug-like lead compound to exert antitumor activity both in vitro and in a mouse xenograft tumor model. Our research provides new employable proteolysis targeting chimera (PROTAC) moieties for targeted protein degradation, providing new possibilities for drug discovery.

Citation: Wang Y, Wei T, Zhao M, Huang A, Sun F, Chen L, et al. (2024) Alkenyl oxindole is a novel PROTAC moiety that recruits the CRL4DCAF11 E3 ubiquitin ligase complex for targeted protein degradation. PLoS Biol 22(5): e3002550. https://doi.org/10.1371/journal.pbio.3002550 Academic Editor: Alessio Ciulli, University of Dundee, UNITED KINGDOM Received: January 31, 2024; Accepted: April 17, 2024; Published: May 20, 2024 Copyright: © 2024 Wang et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability: Data supporting the findings of this study are available in the paper and its supporting information files. FCS files underlying the Flow Cytometry data of this paper are accessible in the FlowRepository database, the accession numbers are FR-FCM-Z7CY (Figs 3C and 4C), FR-FCM-Z7BP (Fig 5B), FR-FCM-Z7BV (Figs 5D and S7A) and FR-FCM-Z7BT (S6A Fig). Funding: This work was supported by the National Natural Science Foundation of China (22271317 to L.H., 22101306 to Ming Z., 32100766 and 82171416 to R.T.), the Medical Innovation and Development Project of Lanzhou University (lzuyxcx-2022-156 to R.W.), the CAMS Innovation Fund for Medical Sciences (CIFMS) (2019-I2M-5-074, 2021-I2M-1-026, 2021-I2M-3-001 and 2022-I2M-2-002 to R.W.), Guangdong Basic and Applied Basic Research Foundation (2023B1515020075 to R.T.), the Science, Technology and Innovation Commission of Shenzhen Municipality (RCBS20210609103800006, JCYJ20220530112602006 and RCYX20221008092845052 to R.T.), the Lingang Laboratory Grant (LG-QS-202203-11 to R.T.) and the China Postdoctoral Science Foundation (2023M731523 to T.W.). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors have declared that no competing interests exist. Abbreviations: ATTEC, autophagosome-tethering compound; AUTAC, autophagy targeting chimera; BRD4, bromodomain-containing protein 4; BD1, bromodomain 1; CRISPRi, CRISPR interference; CRL, Cullin-RING E3 ligase; CUL4B, cullin-4B; DDB1, damage-specific DNA binding protein 1; DCAF11, DDB1 and CUL4 associated factor 11; EGFP, enhanced green fluorescent protein; FACS, fluorescence activated cell sorting; FBS, fetal bovine serum; HDR, homology-directed repair; HPLC, high-performance liquid chromatography; HRMS, high-resolution mass spectra; LYTAC, lysosome targeting chimera; mHTT, mutant huntingtin protein; NAE1, NEDD8 activating E1 enzyme; NMR, nuclear magnetic resonance; OD, optical density; PI, propidium iodide; PROTAC, proteolysis targeting chimera; RBX1, RING-finger protein RING-box1; RT, room temperature; RT-qPCR, quantitative reverse transcription PCR; TGI, tumor growth inhibition rate; TLC, thin-layer chromatography; TPD, targeted protein degradation; UBA3, ubiquitin like modifier activating enzyme 3

Introduction Targeted protein degradation (TPD) has emerged as a promising approach for drug discovery. It uses multispecific small molecules to selectively recognize target proteins, facilitating their degradation via cell’s intrinsic protein degradation pathways [1]. Compared with traditional inhibitors, TPD drugs possess the unique ability to not only inhibit protein activity but also facilitate the degradation of target proteins. This dual functionality empowers TPD drugs to elicit stronger therapeutic effects and holds promise for targeting proteins that were previously deemed “undruggable” [2–4]. Currently, TPD strategies primarily utilize 2 major degradation pathways: the ubiquitin-proteasome system and the lysosomal degradation pathway [5–7]. According to mechanism of action, the major TPD strategies include proteolysis targeting chimeras (PROTACs), lysosome targeting chimeras (LYTACs), and autophagy targeting chimeras (AUTACs) [8–11]. Among them, PROTAC technology is the most extensively studied and has achieved significant breakthroughs. It has been successfully applied to degrade more than 100 target proteins, including those previously considered “undruggable” [12]. Moreover, more than 20 PROTACs are currently undergoing clinical trials since 2019 [13–16], indicating that PROTAC technology is a promising strategy for drug discovery. PROTACs are heterobifunctional molecules consisting of 2 ligand domains joined by a chemical linker. One ligand domain binds to the protein target of interest, and the other ligand recruits an E3 ubiquitin ligase. By engaging with both the target protein and E3 ligase simultaneously, PROTACs facilitate the polyubiquitination and proteasomal degradation of the target protein [17]. While over 600 E3 ligases have been identified in the human genome [18], only a small fraction (<3%) have been successfully recruited by PROTACs [19]. The most commonly utilized E3 ligases include CRBN, VHL, MDM2, and IAPs. More recently, KEAP1 [20,21], RNF114 [22,23], DCAF15 [24], and DCAF16 [25] have expanded the toolbox of accessible E3 ligases. However, the vast majority (>90%) of reported PROTAC molecules continue to rely on just 2 ligases: CRBN and VHL [12]. This narrow E3 diversity poses a major challenge, as the development and targeting potential of PROTAC degraders is constrained by the limited pool of recruited E3s. Therefore, broadening the range of E3 ligases that can be engaged by small molecule ligands could unlock new avenues to potentially degrade a wider range of protein targets, as well as circumvent the acquired drug resistance that caused by mutations in certain E3 ligases [26,27]. The alkenyl oxindole framework is commonly found in synthetic or natural compounds that exhibit a wide range of biological activities and have attracted research interests from pharmacologists and chemists [28]. Many alkenyl oxindoles have been developed as lead compounds or marketed drugs against tumors, such as sunitinib [29–31]. Recently, 2 alkenyl oxindoles (10O5 and AN1) were found to act as molecular glues that tether mutant huntingtin protein (mHTT) to autophagy-related protein LC3, leading to the autophagy-lysosomal degradation of mHTT [32]. This prompted us to test whether this strategy can be expanded to degrade other substrates. To this end, we synthesized a series of heterobifunctional molecules by linking BRD4 inhibitor JQ1 with different alkenyl oxindoles, followed by assessing their targeted degradation activity. This led to the identification of HL435, a highly potent alkenyl oxindole-based BRD4 degrader. However, when we investigated the protein degradation mechanism of HL435, we found that it degraded BRD4 through the ubiquitin-proteasome system rather than the autophagy-lysosomal pathway. Based on this unexpected finding, we hypothesized that alkenyl oxindoles may act as novel E3 ligase ligands. To verify our hypothesis, we performed a pooled CRISPR interference (CRISPRi) screening, from which we revealed that the E3 ligase complex CRL4DCAF11 is in charge of HL435-induced proteasomal degradation of BRD4. We further validated the antitumor efficacy of HL435 both in vitro and in vivo. Overall, we discovered that alkenyl oxindoles can act as recruitment moiety for CRL4DCAF11 and developed alkenyl oxindole-based PROTAC molecules with high degradation efficiency and antitumor effects, expanding the toolbox of E3 ligases available for PROTAC drug development.

Discussion and conclusions Two alkenyl oxindoles (10O5 and AN1) have been characterized as molecular glues that tether mHTT to LC3, enabling the lysosomal degradation of mHTT [32]. We initially sought to expand the versatility of this approach by conjugating alkenyl oxindoles to other substrate binding moieties, generating bifunctional molecules that may facilitate the degradation of various substrate proteins through the autophagy-lysosomal pathway. As a proof-of-principle, we generated a series of JQ1-alkenyl oxindole conjugates, from which we indeed identified molecules that potently degrade the target BRD4. However, when investigating the protein degradation mechanism of JQ1-alkenyl oxindole conjugates, we discovered that it does not occur via the autophagy-lysosomal pathway, but through the ubiquitin-proteasome system. We speculated that the alkenyl oxindole structure may recruit E3 ubiquitin ligase for their degradation activity. To determine the responsible E3 ubiquitin ligase, we conducted a pooled CRISPRi screening, from which we identified the CRL4DCAF11 complex as a potential target for mediating the degradation activity of JQ1-alkenyl oxindole conjugates. We showed that alkenyl oxindoles can recruit DCAF11, thus acting as a novel PROTAC moiety for targeted protein degradation. Previously, the Cravatt [37] and Gray [38] groups, respectively, revealed that DCAF11 serves as an E3 ligase that can support protein degradation triggered by electrophilic PROTACs. Very recently, while we were preparing this manuscript for reviewing, similar findings were reported by Waldmann and Winter and colleagues [39]. Coincidentally but inevitably, their research work also validated that the degraders developed from conjugating with 10O5 recruit the E3 ubiquitin ligase CRL4DCAF11 for the proteasomal degradation of substrate proteins, instead of autophagy-lysosome. As alkenyl oxindoles possesses Michael acceptor properties, they believed that they recruit DCAF11 through a covalent modification approach, potentially engaging with cysteine residues [39]. While a recent major report from the Ciulli and Winter labs identified a weak intrinsic affinity between BRD4 and DCAF11, and intramolecular glue degraders could enhance the surface complementarity between them by conformational modification, which can trigger productive ubiquitination and degradation of BRD4 [40]. These findings not only support our conclusions but also provide insights into the mechanism by which alkenyl oxindoles recruit DCAF11 to degrade target proteins. Previous structure-activity studies on PROTACs have mainly focused on the effects of different linkers on degradation activity, with few studies on the structure-activity of the E3 ligase ligand part. In this study, we found that the ability to degrade BRD4 were significantly improved through structural optimization of E3 ligase ligands, and an excellent BRD4 degrader HL435 was identified, whose JQ1 moiety was conjugated with the trifluoromethyl-substituted alkenyl oxindole via PEG chain. The D max of HL435 >99%, with DC 50 values of 11.9 nM in MDA-MB-231 cells. To explore the druggability potential of heterobifunctional compounds conjugated with alkenyl oxindoles, we evaluated their antitumor abilities both in vitro and in vivo. Most of heterobifunctional compounds exhibited more excellent antiproliferation abilities against breast cancer cells than JQ1 or alkenyl oxindoles, supporting the more excellent therapeutic potential of degraders compared to inhibitors. Consistent with the degradation efficiency of BRD4, HL435 showed the best antiproliferative activity overall, with an IC 50 as low as 8.7 nM against prostate cancer cells 22RV1. In addition to outstanding antiproliferative abilities against multiple tumor cells, HL435 can effectively arrest the cell cycle and induce apoptosis in breast cancer cells by blocking BRD4 downstream signaling pathway in a concentration-dependent manner. Finally, the antitumor efficacy of HL435 in vivo was validated in a mouse MDA-MB-231 xenograft model, with good tolerability. These data suggested that HL435, a compound composed of structure modified alkenyl oxindole and BRD4 inhibitor JQ1, was a promising drug-like lead compound for anticancer drug development. Although there are more than 600 E3 ubiquitin ligases in human cells, the ligand molecules currently available to recruit E3 ubiquitin ligases only cover less than 3% [18,19]. In addition, with the emergence of E3 ubiquitin ligase resistance, PROTACs based on the same E3 ubiquitin ligase ligand may be ineffective [41–43]. Therefore, the development of new E3 ubiquitin ligase ligands can not only solve the limitations of existing ligands, but also be a major way to expand the scope of PROTACs therapeutic targets and provide better treatment opportunities [26]. Moreover, as DCAF11 is localized in the nucleus, the identification of ligands capable of recruiting DCAF11 provides new possibilities for targeting the degradation of nuclear proteins. In summary, we discovered alkenyl oxindole as a novel PROTAC moiety for targeted protein degradation via CRL4DCAF11 recruitment. We also developed JQ1-alkenyl oxindole-conjugated bifunctional molecules with high BRD4 degradation efficiencies in multiple cell lines and proved their anticancer effect both in vitro and in vivo. Our study expands the E3 toolbox available for PROTACs, which will potentially broaden the spectrum of degradable proteins and improve the efficiency of target degradation, as well as circumvent the acquired drug resistance caused by mutations in certain E3 ligases, providing new possibilities for drug discovery.

Materials and methods Ethics statement The animal experiment was conducted strictly according to animal ethics guidelines and the protocol (No. SYSU-IACUC-2023-000327), approved by the Institutional Animal Care and Use Committee (IACUC) of Sun Yat-sen University Cancer Center. Cell lines culture and plasmid transfection HCT116, MCF-7, 22RV1, A549, K562, THP-1, Hela, and HEK293T cell lines were previously obtained from ATCC and cryopreserved in our laboratory. MDA-MB-231 was newly purchased from Procell (Wuhan, China). ATG4BKO-Hela, ATG5KO-Hela, ATG4BKO-HCT116 were kindly gifts from Professor Li (Sun Yat-sen University). The CRISPRi HEK293T cell line was established by integrating dCas9-BFP-KRAB cassette into the CLYBL safe harbor locus via homology-directed repair (HDR) as described previously [33]. All cell lines were mycoplasma-free. HA-Ub and Flag-BRD4 plasmids were purchased from Miaoling Biology (Wuhan, China). Cell lines were cultured in RPMI-1640 medium (Gibco, Thermo Fisher Scientific, Waltham, MA, USA) or DMEM (Gibco) supplemented with 1% penicillin-streptomycin (Gibco) and 10% fetal bovine serum (FBS, sigma), the cultures were maintained in a CO 2 incubator at 37°C with 5% (v/v) CO 2 . For transient transfection, HEK293T cells were seeded into 6-well plates and cultured to about 50% density, then cotransfected with HA-Ub and Flag-BRD4 plasmids for 32 hours (Flag-BD1 and HA-DCAF11 plasmids for 48 hours) by Hieff Trans Liposomal Transfection Reagent (Yeasen, China). DNA constructs The coding sequence of BRD4 BD1 domain (amino acid N44-E168) was amplified from full-length of BRD4 cDNA in a pcDNA3.1-BRD4-3Flag with the forward primer (5′-ATGACGATGACAAGACTAGTaaccccccgcccccagagacctcca-3′) and reverse primer (5′-ccgccttcttctgtgggtagctcatttatt-3′), and it was fused with mScarlet-P2A-EGFP from pRT117 vector into the pLVX-3Flag-Hygro vector with the forward primer (5′-ctacccacagaagaaGGCGGTGGCTCGGTGAGCAA-3′) and reverse primer (5′-AGGGGCGGGATCCGCGGCCGCttactagtcggttcaactctaggtg-3′) by Hieff Clone Universal One Step Cloning Kit (YEASEN, 10922ES20). The coding sequence of DCAF11 (Youbio, L11006) was inserted into a pcDNA3.1-3HA vector with the forward primer (5′- TACCTGACTACGCTGGTACCatgggatcgcggaacagcagcag-3′) and reverse primer (5′- GATATCTGCAGAATTCctactggggtgaggaaaaggg-3′) by Hieff Clone Universal One Step Cloning Kit (YEASEN, 10922ES20). CRISPRi screening The overall CRIPSRi screening process was performed as described previously [33,44,45]. In brief, HEK293T cells harboring the BRD4 BD1 domain dual fluorescence reporter were infected with the sgRNA library targeting all human E1, E2, and E3 enzymes as described previously. The MOI value was controlled under 0.3 when library was transduced to the cells. The cells were selected by 2 μg/mL puromycin for 2 days. After expansion and puromycin selection, the cells were treated with DMSO and HL435, respectively. Five million cells were taken as “input” 24 hours later, and the remaining cells were subsequently collected for FACS, where the cells were sorted into the top 25% based on the ratio of mScarlet and EGFP signal. For each sample, cells corresponding to at least 4,000-fold over the library coverage were sorted per replicate. Sorted populations were collected and genomic DNA was isolated using DNAiso Reagent (Takara, 9770A). sgRNA cassettes were amplified by PCR and subjected to next-generation sequencing (NGS) by NovaSeq 6000 PE150. Sequencing results were analyzed using MAGeCK-iNC as previously described [33]. Cell viability assay Cells were seeded in 96-well plates at a density of 2,000 to 4,000 cells per well. After overnight incubation, compounds were administered at the gradient concentrations for 2 to 3 days. Then, remove the old medium and add 100 μL fresh medium with 10% CCK8 reagent (Bimake; Selleck Chemicals; cat. no. B34304) for each well. And the plate was incubated in a cell incubator at 37°C for 1 to 3 hours. The optical density (OD) value at 450 nm, which stands for the vitality of the cells, was detected with a BioTek Synergy H1 microplate reader. IC 50 values of compounds against cell lines were calculated from triplicate measurements. Co-immunoprecipitation and western blot analysis Cells were lysed in RIPA buffer (Beyotime, Haimen, China) supplemented with phosphatase inhibitors (Bimake; Selleck Chemicals, Houston, TX, USA) or protease inhibitor cocktail (Roche, Basel, Switzerland). The protein in each sample was quantified by a BCA protein assay (Thermo Fisher, Rockford, IL) and boiled with 5×loading buffer (LB) for 5 minutes. For immunoprecipitation, 1 mg protein in each sample was incubated with anti-Flag (P2115, Beyotime, China) or anti-HA magnetic beads (P2121, Beyotime, China) overnight at 4°C. After washed away nonspecifically bound proteins, anti-Flag magnetic beads were boiled with 1× LB for transsexual washout. To separate protein samples, 8%, 10%, and 12% SDS-PAGE gels or 3% Tris-Acetate Polyacrylamide Gradient Gels were used and then transferred to a PVDF membrane (Millipore; Merck KGaA). About 5% skim milk was used to block membranes at room temperature (RT) for 1 hour. Primary antibodies were blotted at 4°C overnight. The next day, the membranes were slowly flipped in secondary antibodies conjugated with horseradish peroxidase for 1 hour at RT. Images were captured by Tanon 5200 (Shanghai, China). Image J was used to quantify the intensities of bands. The antibodies used in this paper were as below: Anti-α-Tubulin (T6047) , anti-LC3B (L7543) and anti-β-Actin were purchased from Sigma (St. Louis, MO, USA); Anti-BRD4 (13440), anti-PARP1 (9542), anti-Caspase 9 (9505), anti-HA (3724), and anti-Cyclin D1 (2922) were purchased from Cell Signaling Technology (Danvers, MA); Anti-Ubiquitin (sc-8017) was from Santa Cruz (Dallas, TX, USA). Anti-ATG4B (M134), anti-ATG5 (M153), and anti-Flag were from MBL (Tokyo, Japan); anti-Cyclin B1(55004-1-AP), anti-p53 (10442-1-AP), anti-p21 (10355-1-AP), anti-c-Myc (10828-1-AP), and anti-GAPDH (60004-1-Ig), anti-Vinculin (66305-1-Ig), goat anti-mouse IgG (H+L) (SA00001-1), and goat anti-rabbit IgG (H+L) (SA00001-2) were purchased from Proteintech. Quantitative reverse transcription PCR (RT-qPCR) MDA-MB-231 or MCF-7 cells were plated in 12-well plates and treated with compounds for 12 hours after overnight incubation. Total RNA was extracted using TRIzol (Invitrogen). A High-Capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific) was used to create cDNA from purified RNA. The quantitative real-time PCR (qPCR) was conducted on a real-time fluorescence quantitative PCR equipment (light-Cycler480II, Roche) according to the protocol of SYBR Green qPCR Mix (Dongsheng Biotech, China). Results analyses were performed from 3 or 4 biological replicates; each data in biological replicate was triplicate. The expression level of genes was calculated with the 2−ΔΔCt technique, and GAPDH or Tubulin was used as an internal reference. The expression level of each gene in the DMSO group was normalized to 1, and that of treatment groups were presented as fold-change relative to the DMSO group. The primer sequences used were as follows: GAPDH-F: GAGTCAACGGATTTGGTCGT, GAPDH-R: GACAAGCTTCCCGTTCTCAG; BRD4-F: CTCCGCAGACATGCTAGTGA, BRD4-R: GTAGGATGACTGGGCCTCTG; c-MYC-F: CACCGAGTCGTAGTCGAGGT, c-MYC-R: GCTGCTTAGACGCTGGATTT; P21-F: TGTCCGTCAGAACCCATGC, P21-R: AAAGTCGAAGTTCCATCGCTC; DCAF11-F: CAATGATCTGGGCTTCACTGAT, DCAF11-R: TCTTGGCAAGCAGACATGAAT; DDB1-F: ATGTCGTACAACTACGTGGTAAC, DDB1-R: CGAAGTAAAGTGTCCGGTCAC; NAE1-F: ACCTGTTCGAGGCACAATTCC, NAE1-R: TCTTTGCTTTTTCACGGTAAACG; UBA3-F: CGATCTGGACCCTTCACACAC, UBA3-R: GCCAGCTCCAATGACTAGAAC; CUL4B-F: ACTCCTCCTTTACAACCCAGG, CUL4B-R: TCTTCGCATCAAACCCTACAAAC; RBX1-F: TTGTGGTTGATAACTGTGCCAT, RBX1-R: GACGCCTGGTTAGCTTGACAT; Tubulin-F: ACCTTAACCGCCTTATTAGCCA, Tubulin-R: ACATTCAGGGCTCCATCAAATC. Cell cycle assay The influence of compounds on the cell cycle was detected by cell flow cytometry following instructions of the Cell Cycle Analysis Kit (C1052, Beyotime). In brief, seed cells into a 6-well plate at an appropriate density. After overnight incubation, compounds were administered at the respective concentration for 24 hours. Precooled PBS was used to wash cells before and after centrifugation, followed by overnight fixation in 70% ethanol at 4°C. On the next day, ethanol was removed by centrifugation, then cells were dealt with RNase for 30 minutes at 37°C. Subsequently, they were stained with propidium iodide (PI) at RT for an additional 30 minutes. If stored at 4°C, the stained cells can be detected on a flow cytometer (BD FACSCalibur, BD Biosciences, USA) within 24 hours and analyzed for cell cycle distribution using FlowJo software. Cell apoptosis assay The effect of compounds on inducing apoptosis was detected using cell flow cytometry according to the instructions of Annexin V APC/7-AAD apoptosis kit (AP105-100, liankebio, China). In brief, seed cells into a 6-well plate at an appropriate density. On the next day, compounds were administered at the respective concentrations for 36 hours. Around 500 μL 1× binding buffer was used to resuspend the harvested cells, and then add Annexin V-APC (5 μL) and 7-AAD (10 μL). Gently mix the solution and incubate it in the dark at RT for 5 minutes. Finally, a flow cytometer (BD FACSCalibur, BD Biosciences, USA) was employed to detect the cells as soon as possible. Animal experiment Animal experiment was performed at the Experimental Animal Center of Sun Yat-sen University (East Campus), and female NOD-SCID mice were purchased from Guangdong Yaokang Biotechnology. Inject subcutaneously 5 million MDA-MB-231 cells on the right dorsal side of each mouse at the age of 6 to 7 weeks. When tumors size reached 60 to 70 mm3 about half a month later, mice were randomly divided into 2 groups. Mice were daily injected with vehicle (10% DMSO + 90% corn oil, IP) or HL435 (20 mg/kg, IP) 6 days per week for 27 days. Volume of xenograft tumor and body weight of each mouse were measured every 2 to 4 days. Volume of xenograft tumor = length × width2/2. Kill all of mice at day 27 posttreatment and xenograft tumors were excised for weight measurement. TGI (%) = [1 − (TV Treatment/Dx − TV Treatment/D1 ) / (TV Vehicle/Dx − TV Vehicle/D1 )] × 100%, X = days posttreament. Chemistry Unless otherwise stated, all solvents and the compounds without provided synthesis routes were commercially purchased. All solvents were purified and dried according to standard methods before use. The spectra of 1H nuclear magnetic resonance (NMR) was recorded on a Varian instrument (500 MHz or 400 MHz), and the tetramethylsilane signal or residual protio solvent signals was used as the internal standard. 13C NMR was recorded on a Varian instrument (125 MHz or 100 MHz). Data for 1H NMR were recorded as follows: chemical shift (δ, ppm), multiplicity (s = singlet, d = doublet, t = triplet, m = multiplet, q = quartet or unresolved, coupling constant (s) in Hz, integration). Data for 13C NMR were reported in terms of chemical shift (δ, ppm). The progress of the reaction was monitored by thin-layer chromatography (TLC) on glass plates coated with a fluorescent indicator (GF254). Flash column chromatography was performed on silica gel (200 to 300 mesh). The ESI ionization sources were employed to obtain high-resolution mass spectra (HRMS). The purity of final key products was confirmed by a Waters e2695 HPLC system equipped with an XBridge C18 (5 um, 4.6 × 250 mm) and eluted with methanol/water (97.5:2.5) at a flow rate of 1.0 mL/minute. The yields indicated were from single step reactions. All compounds used in biological tests have been further purified by preparative liquid chromatography, and all of them showed >95% purity using the HPLC methods described above.

Acknowledgments We thank Professor Min Li (Sun Yat-sen University) for his kindly gifts (ATG4BKO-Hela, ATG5KO-Hela, ATG4BKO-HCT116 cell lines). We thank Dr. Xibin Lu for his guidance of FACS and SUSTech Core Research Facilities for their support on our project.

[END]
---
[1] Url: https://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.3002550

Published and (C) by PLOS One
Content appears here under this condition or license: Creative Commons - Attribution BY 4.0.

via Magical.Fish Gopher News Feeds:
gopher://magical.fish/1/feeds/news/plosone/

You are viewing proxied material from magical.fish. The copyright of proxied material belongs to its original authors. Any comments or complaints in relation to proxied material should be directed to the original authors of the content concerned. Please see the disclaimer for more details.