(C) PLOS One
This story was originally published by PLOS One and is unaltered.
. . . . . . . . . .
Spoink, a LTR retrotransposon, invaded D. melanogaster populations in the 1990s [1]
['Riccardo Pianezza', 'Institut Für Populationsgenetik', 'Vetmeduni Vienna', 'Vienna', 'Vienna Graduate School Of Population Genetics', 'Almorò Scarpa', 'Prakash Narayanan', 'Biological Sciences', 'North Dakota State University', 'Fargo']
Date: 2024-04
During the last few centuries D. melanogaster populations were invaded by several transposable elements, the most recent of which was thought to be the P-element between 1950 and 1980. Here we describe a novel TE, which we named Spoink, that has invaded D. melanogaster. It is a 5216nt LTR retrotransposon of the Ty3/gypsy superfamily. Relying on strains sampled at different times during the last century we show that Spoink invaded worldwide D. melanogaster populations after the P-element between 1983 and 1993. This invasion was likely triggered by a horizontal transfer from the D. willistoni group, much as the P-element. Spoink is probably silenced by the piRNA pathway in natural populations and about 1/3 of the examined strains have an insertion into a canonical piRNA cluster such as 42AB. Given the degree of genetic investigation of D. melanogaster it is perhaps surprising that Spoink was able to invade unnoticed.
It was, however, widely assumed until now that the P-element invasion, which occurred between 1950–1980, was the last and most recent TE invasion in D. melanogaster [ 21 , 29 , 31 , 35 , 36 ]. Here we report the discovery of Spoink, a novel TE which invaded worldwide D. melanogaster populations between 1983 and 1993, i.e. after the invasion of the P-element. Spoink is a LTR retrotransposon of the Ty3/gypsy group. We suggest that the Spoink invasion in D. melanogaster was triggered by horizontal transfer from a species of the willistoni group, similarly to the P-element invasion in D. melanogaster. In a model species as heavily investigated as D. melanogaster it is perhaps surprising that Spoink was able to invade undetected.
Transposable elements (TEs) are short genetic elements that can increase in copy number within the host genome. They are abundant in most organisms and can make up the majority of some genomes, i.e. maize where TEs constitute 83% of the genome [ 1 ]. There are two classes of TEs which transpose by different mechanisms—DNA transposons which replicate by directly moving to a new genomic location in a ‘cut and paste’ method, and retrotransposons which replicate through an RNA intermediate in a ‘copy and paste’ method [ 2 – 4 ]. From humans to flies, more genetic variation (in bp) is due to repetitive sequences such as transposable elements than all single nucleotide variants combined [ 5 ]. Although some TEs, such as R1 and R2 elements, may benefit hosts [ 6 , 7 ] most TE insertions are thought to be deleterious [ 8 , 9 ]. Host genomes have therefore evolved an elaborate system of suppression frequently involving small RNAs [ 10 ]. Suppression of TEs in Drosophila relies upon small RNAs termed piRNA, which are cognate to TE sequences [ 11 – 13 ]. These small RNAs bind to PIWI clade proteins and mediate the degradation of TE transcripts and the formation of heterochromatin silencing the TE [ 11 , 14 – 19 ]. However, while host defenses quickly adapt to new transposon invasions, TEs can escape silencing through horizontal transfer to new, defenseless, genomes [ 20 – 23 ]. This horizontal transfer allows TEs to colonize the genomes of novel species [ 20 , 23 – 26 ]. The first well-documented instance of horizontal transfer of a TE was the P-element, which spread from D. willistoni to D. melanogaster [ 27 ]. Following this horizontal transfer the P-element invaded natural D. melanogaster populations between 1950 and 1980 [ 28 , 29 ]. It was further realized that the I-element, Hobo and Tirant spread in D. melanogaster populations earlier than the P-element, between 1930 and 1960 [ 29 – 31 ]. The genomes from historical D. melanogaster specimens collected about two hundred years ago, recently revealed that Opus, Blood, and 412 spread in D. melanogaster populations between 1850 and 1933 [ 21 ]. In total, it was suggested that seven TEs invaded D. melanogaster populations during the last two hundred years where one invasion (the P-element) was triggered by horizontal transfer from a species of the willistoni group and six invasions by horizontal transfer from the simulans complex [ 21 , 27 , 31 – 34 ].
To identify the origin of the horizontal transfer of Spoink we used RepeatMasker [ 37 ] (open-4.0.7; -no-is -s -nolow) to identify sequences with similarity to Spoink in the long-read assemblies of 101 drosophilid species and in 99 different insect species [ 67 , 68 ] ( S8 Table ). We included the long-read assembly of the D. melanogaster strain RAL737 and of the D. simulans strain SZ129 in the analysis [ 23 , 40 ]. We used a Python script to identify in each assembly the best hit with Spoink (i.e. the highest alignment score) and than estimated the similarity between this best hit and Spoink. The similarity was computed as s = rms best /rms max , where rms best is the highest RepeatMasker score (rms) in a given assembly and rms max the highest score in any of the analysed assemblies. A s = 0 indicates no similarity to the consensus sequence of Spoink whereas s = 1 represent the highest possible similarity. To generate a phylogenetic tree we identified Spoink insertions in the assemblies of the 101 drosophilid species and RAL737 using RepeatMasker. We extracted the sequences of full-length insertions (> 80% of the length) from species having at least one full-length insertion using bedtools [ 49 ] (v2.30.0). A multiple sequence alignment of the Spoink insertions was generated with MUSCLE (v3.8.1551) [ 41 ] and a tree was generated with BEAST (v2.7.5) [ 45 ].
We used the frequencies of SNPs in the sequence of Spoink to compute the UMAP. This frequencies reflect the Spoink composition in a given sample. For example if a specimen has 20 Spoink insertions and a biallelic SNP with a frequency of 0.8 at a given site in Spoink than about 16 Spoink insertions will have the SNP and 4 will not have it. The frequency of the Spoink SNPs was estimated with DeviaTE [ 55 ]. Solely bi-allelic SNPs were used and SNPs only found in few samples were removed (≤3 samples). UMAPs were created in R (umap package; v0.2.10.0 [ 66 ]).
To validate whether Spoink is absent in old D. melanogaster strains but present in recent strains we used PCR. We designed two primers pairs for Spoink and one for vasa as a control. We extracted DNA from different strains of D. melanogaster (Lausanne-S, Hikone-R, iso-1, RAL59, RAL176, RAL737) using a high salt extraction protocol [ 61 ]. We designed two primers pairs for Spoink (P1,P2) and one for the gene vasa (P1 FWD TCAGAAGTGGGATCGGGCTCGG, P1 REV CAGTAGAGCACCATGCCGACGC, P2 FWD ATGGACCGTAATGGCAGCAGCG, P2 REV ACACTCCGCGCCAGAGTCAAAC, Vasa FWD AACGAGGCGAGGAAGTTTGC, Vasa REV GCGATCACTACATGGCAGCC). We used the following PCR conditions: 1 cycle of 95°C for 3 minutes; 33 cycles of 95°C for 30 seconds, 58°C for 30 seconds and 72°C for 20 seconds; 1 cycle of 72°C for 6 minutes.
For every putative Spoink insertion (including degraded ones) in the eight long-read assemblies of individuals from Raleigh [ 40 ], we extracted the sequence of the insertion plus 1 kb of flanking sequence with bedtools [ 49 ]. The sequence of the Spoink insertion was removed with seqkit [ 57 ] and the flanking sequences were mapped to the AKA017 genome (i.e. the common coordinate system) with minimap2 allowing for spliced mappings [ 40 , 57 , 58 ]. The mapping location of each read was extracted and if they overlapped between strains they were considered putative shared sites. Regions with overlapping reads were visually inspected in IGV (v2.4.14) and if the mapping location was shared they were considered shared insertions sites [ 59 , 60 ].
We investigated the abundance of Spoink in multiple publicly available short-read data sets [ 31 , 40 , 51 – 53 ]. These data include genomic DNA from 183 D. melanogaster strains sampled at different geographic locations during the last centuries. For an overview of all analysed short-read data see S5 Table . We mapped the short reads to a database consisting of the consensus sequences of TEs [ 43 ] (v9.44), the sequence of Spoink and three single copy genes (rhi, tj, RpL32) with bwa bwasw (version 0.7.17-r1188) [ 54 ]. We used DeviaTE (v0.3.8) [ 55 ] to estimate the abundance of Spoink. DeviaTE estimates the copy number of a TE (e.g. Spoink) by normalizing the coverage of the TE by the coverage of the single copy genes. We also used DeviaTE to visualize the abundance and diversity of Spoink as well as to compute the frequency of SNPs in Spoink (see below).
Genes were annotated in each of the 31 genomes from [ 40 ] using the annotation of the reference genome of D. melanogaster (6.49; Flybase) and liftoff 1.6.3 [ 46 , 47 ]. The 1kb regions upstream of each gene were classified as putative promotors. The location of canonical D. melanogaster piRNA clusters was determined using CUSCO, which lifts over the flanks of known clusters in a reference genome to locate the homologous region in a novel genome [ 48 ]. The location of Spoink insertions within genes or clusters was determined with bedtools intersect [ 49 ]. To determine if genic insertions were shared or independent, the sequence of the insertion was extracted from each genome along with an extra 1 kb of flanking sequence on each end. Insertions purportedly in the same gene were then aligned, and if the flanks aligned they were considered shared insertions. To determine if cluster insertions were shared the flanking TE regions were aligned using Manna, which aligns TE annotations rather than sequences, to determine if there was any shared synteny in the surrounding TEs [ 50 ].
We picked several sequences from each of the known LTR superfamily/groups using the consensus sequences of known TEs [ 2 , 43 ] (v9.44). We performed a blastx search against the NCBI database to identify the RT domain in the consensus sequences of the TE [ 44 ]. We then performed a multiple sequence alignment of the amino-acid sequences of the RT domain using MUSCLE (v3.8.1551) [ 41 ]. We obtained the xml file using BEAUti2 [ 45 ] (v2.7.5) and generated the trees with BEAST (v2.7.5) [ 45 ]. The maximum credibility tree was built using TreeAnnotator (v2.7.5) [ 45 ] and visualized with FigTree (v1.4.4,
http://tree.bio.ed.ac.uk/software/figtree/ ).
However, Spoink insertions in D. melanogaster are nested within insertions from species of the willistoni group ( Fig 5B ). Our data thus suggest that, similar to the P-element invasion in D. melanogaster [ 27 ], the Spoink invasion in D. melanogaster was also triggered by horizontal transfer from a species of the willistoni group. The synonymous divergence of Spoink is lower than for any of 140 single copy orthologous genes shared between D. melanogaster and D. willistoni, further supporting the recent horizontal transfer of Spoink ( S9 Fig ) [ 20 , 85 , 86 ]. Species of the willistoni group are Neotropical, occurring throughout Central and South America [ 87 – 89 ]. Therefore horizontal transfer of Spoink only became feasible after D. melanogaster extended its habitat into the Americas approximately 200 years ago [ 90 – 92 ]. Insertions of D. cardini are next to species of the willistoni group, suggesting that D. cardini also acquired Spoink by horizontal transfer from the willistoni group, likely independent of D. melanogaster ( Fig 5B ). D. cardini is also a Neotropical species and its range overlaps many species of the willistoni group, thus horizontal transfer between the species is physically feasible [ 93 , 94 ].
A) Similarity of TE insertions in long-read assemblies of diverse drosophilid species to Spoink. The barplots show for each species the similarity between Spoink and the best match in the assembly. For example, a value of 0.9 indicates that at least one insertion in an assembly has a high similarity (≈ 90%) to the consensus sequence of Spoink. B) Bayesian tree of Spoink insertions in the different drosophilid species. Only full-length insertions of Spoink (> 80% of the length) were considered. Node support values are posterior probabilities estimated by BEAST [ 45 ]. Note that Spoink insertions of D. melanogaster are nested in insertions from the willistoni group (blue shades).
The invasion of Spoink in D. melanogaster was likely triggered by horizontal transfer from a different species. To identify the source of the horizontal transfer we investigated the long-read assemblies of 101 Drosophila species [ 67 ] (and D. simulans strain SZ129) and of 99 insect species [ 23 , 67 , 68 ] ( S8 Table ). We did not consider short-read assemblies, as TEs may be incompletely represented in them [ 48 ]. Apart from D. melanogaster we found insertions with a high similarity to Spoink in D. sechellia, in one out of two D. simulans assemblies (in SZ129 but not in 006), and species of the willistoni group, in particular D. willistoni ( Fig 5A ). In agreement with this, a sequence from D. willistoni with a high similarity to Spoink can be found in RepBase (Gypsy-78_DWil; I: 99.73% similarity, LTR: 93.54% similarity [ 84 ]). Spoink insertions with a somewhat smaller similarity were found in D. cardini and D. repleta. No sequences similar to Spoink were found in the 99 insect species ( S7 Fig ). To further shed light on the origin of the Spoink invasion we constructed a phylogenetic tree with full-length insertions of Spoink in D. melanogaster, D. sechellia, D. simulans (SZ129) D. cardini and species of the willistoni group ( Fig 5B and for a star phylogeny see S8 Fig ). We did not find a full-length insertion of Spoink in D. repleta. This tree reveals that Spoink insertions in D. sechellia and D. simulans have very short branches. Furthermore, in D. simulans just one out of the two analysed assemblies has Spoink insertions. We thus suggest that the Spoink invasion in these two species is also of recent origin (manuscript in preparation).
It is an important open question as to which events trigger the emergence of piRNA based host defence. The prevailing view, the trap model, holds that the piRNA based host defence is initiated by a copy of the TE jumping into a piRNA cluster [ 17 , 25 , 79 – 81 ]. If this is true we expect Spoink insertions in piRNA clusters in each of the long-read assemblies of the recently collected D. melanogaster strains [ 40 ]. We identified the position of piRNA clusters in these long-read assemblies based on unique sequences flanking the piRNA clusters [ 48 ]. Interestingly, we found an extremely heterogeneous abundance of Spoink insertions in piRNA clusters, where some strains (e.g. RAL176) have up to 14 cluster insertions whereas 18 out of 31 strains did not have a single cluster insertion ( S7 Table ). Three of the cluster insertions were into 42AB, which usually generates the most piRNAs [ 11 , 69 ]. It is an important open question whether such a heterogeneous distribution of Spoink insertions in piRNA clusters is compatible with the trap model [ 82 , 83 ]. In summary we found evidence that Spoink is silenced by the piRNA pathway but the number of Spoink insertions in piRNA clusters is very heterogeneous among strains.
The host defence against TEs in Drosophila is based on small RNAs termed piRNAs. These piRNAs bind to PIWI clade proteins and silence a TE at the transcriptional as well as the post-transcriptional level [ 11 , 12 , 14 , 77 ]. To test whether Spoink is silenced in D. melanogaster populations we investigated small RNA data from the GDL lines [ 62 ]. Small RNA were sequenced for 10 out of the 84 GDL lines such that two strains were picked from each of the five continents [ 62 ].
Previous work showed that the composition of TEs within a species may differ among geographic regions [ 21 , 31 ]. Such geographic heterogeneity could result from founder effects occurring during the geographic spread of a TE. For example, a TE spreading in a species with a cosmopolitan distribution such as D. melanogaster may need to overcome geographic obstacles such as oceans and deserts. The few individuals that overcome these obstacles, thereby spreading the TE into hitherto naive populations, may carry slightly different variants of the TE than the source populations. These distinct variants will then spread in the new population. Such founder effects during the invasion may lead to a geographically heterogeneous composition of a TE within a species. For example, for the retrotransposon Tirant, individuals sampled from Tasmania carry distinct variants [ 31 ], while for 412 and Opus individuals from Zimbabwe are distinct from the other populations [ 21 ]. To investigate whether we find such geographic heterogeneity we analysed the Spoink composition in the Global Diversity Lines (GDL), which comprise 85 D. melanogaster strains sampled after 1988 from five different continents (Africa—Zimbabwe, Asia—Beijing, Australia—Tasmania, Europe—Netherlands, America—Ithaca; [ 51 ]). Except for a single strain from Zimbabwe all GDL strains harbour Spoink insertions ( S5 Fig ). We estimated the allele frequency of SNPs in Spoink, where a SNP refers to a variant among dispersed copies of Spoink. The allele frequency estimate thus reflects the composition of Spoink within a particular strain. To summarize differences in the composition among the GDL strains we used UMAP [ 76 ]. We found that the composition of Spoink varies among regions where three distinct groups can be distinguished: Tasmania, Bejing/Ithaca and Netherlands/Zimbabwe ( S5 Fig ). It is interesting that clusters are formed by geographically distant populations such as Bejing (Asia) and Ithaca (America). We speculate that human activity, where flies might for example hitchhike with merchandise, could be responsible for this pattern. In summary, we found a geographically heterogeneous composition of Spoink which is likely due to founder effects occurring during the spread of this TE.
Finally we estimated the abundance of Spoink in 49 long-read assemblies of strains collected during the last 100 years ( S6 Table ; [ 39 , 40 , 48 , 56 ]). We used RepeatMasker [ 37 ] to estimate the abundance of canonical Spoink insertions (> 80% length and < 5% divergence) in these strains. Canonical Spoink insertions were absent in strains collected before 1975 but present in all long-read assemblies of strains collected after 2003 ( Fig 3C ). The strains of the assemblies supporting the absence of canonical Spoink insertions were collected from America, Europe, Asia, and Africa whereas the strains showing the presence of Spoink were largely collected from Europe, though genomes from North America and Africa are also represented ( S6 Table ).
Next we sought to provide a more accurate estimate of the time when Spoink spread in D. melanogaster. First we generated a rough timeline of the Spoink invasion using D. melanogaster strains sampled during the last two hundred years. We estimated the abundance of Spoink in these strains using DeviaTE [ 55 ]. As reference we also estimated the abundance of the P-element, which is widely assumed as to be the most recent TE that invaded D. melanogaster populations [ 28 , 31 ]. Spoink was absent from all strains collected ≤1983 but present in strains collected ≥1993 ( Fig 3A ). By contrast our data suggest that the P-element was absent in the strains collected ≤ 1962 but present in strains collected ≥1967 ( Fig 3A ). This is consistent with previous works suggesting that the P-element invaded D. melanogaster between 1950 and 1980 [ 21 , 29 , 35 , 36 ]. Our data thus suggest that Spoink invaded D. melanogaster after the P-element invasion. To investigate the timing of the invasion in more detail we estimated the abundance of Spoink in short-read data of 183 strains collected between 1960 and 2015 from different geographic regions using DeviaTE ( S5 Table ; data from [ 31 , 40 , 51 – 53 ]). The analysis of these 183 strains supports the view that Spoink was largely absent in strains collected ≤ 1983 but present in strains collected ≥ 1993 ( Fig 3B ). However there are two outliers. Spoink is present in one strain collected in 1979 in Providence (USA), which could be due to a contamination of the strain. On the other hand Spoink is absent in one strain collected in 1993 in Zimbabwe ( Fig 3B ). As Spoink was present in six other strains collected in 1993 from Zimbabwe, it is feasible that Spoink was still spreading in populations from Zimbabwe around 1993. The strains supporting the absence of Spoink prior to 1983 were collected from Europe, America, Asia and Africa while the strains supporting the presence of Spoink after 1993 were collected from all five continents ( S5 Table ).
Finally we used PCR to test whether Spoink recently spread in D. melanogaster. We designed two PCR primer pairs for Spoink and, as a control, one primer pair for vasa ( Fig 2C ; bottom panel). The Spoink primers amplified a clear band in three strains collected 2003 in Raleigh but no band was found in earlier collected strains, including the reference strain of D. melanogaster, Iso-1 ( Fig 2C ). We sequenced the fragments amplified by the Spoink primers using Sanger sequencing and found that the sequence of the six amplicons matches with the consensus sequence of Spoink ( S4 Fig ).
Next we investigated the abundance of Spoink in long-read assemblies of a strain collected in 1925 (Oregon-R) and a strain collected in 2003 (RAL737). We found solely highly diverged and fragmented copies of sequences with similarity to Spoink in Oregon-R ( Fig 2B ). These degraded fragments were mostly found near the centromeres of Oregon-R. Investigating the identity of these degraded fragments of Spoink in more detail we found that they largely match with short and highly diverged fragments of Invader6, micropia and the Max-element ( S4 Table ). In addition to these degraded fragments, the more recently collected strain RAL737 also carries a large number of full-length insertions with a high similarity to the consensus sequence of Spoink (henceforth canonical Spoink insertions; Fig 2B ). The canonical Spoink insertions are distributed all over the chromosomes of RAL737 ( Fig 2B ). This observation is again consistent when several long-read assemblies of old and young D. melanogaster strains are analysed ( S3 Fig ).
A) DeviaTE plots of Spoink for a strain collected in 1954 (Hikone-R) and a strain collected in 2015 (Ten-15). Short reads were aligned to the consensus sequence of Spoink and the coverage was normalized to the coverage of single-copy genes. The coverage based on uniquely mapped reads is shown in dark grey and light grey is used for ambiguously mapped reads. Single-nucleotide polymorphisms (SNPs) and small internal deletions (indels) are shown as colored lines. The coverage was manually curbed at the poly-A track (between dashed lines). B) Insertions with a similarity to the consensus sequence of Spoink in the long-read assemblies of Oregon-R (collected around 1925) and the more recently collected strain RAL737 (2003). C) PCR results for two Spoink primer pairs (for location of primers see sketch at bottom) and one primer pair for the gene vasa. Spoink is absent in old strains (Lausanne-S, Hikone-R and Iso-1) and present in more recently collected strains (RAL59, RAL176, RAL737). D) Population frequency of Spoink insertions in long-read assemblies of strains collected in 2003 from Raleigh [ 40 ]. Note that highly diverged insertions are largely segregating at a high frequency while canonical Spoink insertions mostly segregate at a low frequency.
To substantiate our hypothesis that Spoink recently invaded D. melanogaster we used three independent approaches: Illumina short read data, long-read assemblies, and PCR/Sanger sequencing. First we aligned short reads from a strain collected in 1958 (Hikone-R) and a strain collected in 2015 (Ten-15) [ 31 , 40 ] to the consensus sequence of Spoink using DeviaTE [ 55 ]. DeviaTE estimates the abundance of Spoink insertions by normalizing the coverage of Spoink to the coverage of a sample of single-copy genes. Furthermore, DeviaTE is useful for generating an intuitive visualization of the abundance and composition (i.e. SNPs, indels, truncations) of Spoink in samples. We found that only a few degraded reads aligned to Spoink in the 1950’s strain (Hikone-R) whereas many reads covered the sequence of Spoink in the more recently collected strain Ten-15 ( Fig 2A ). There were also very few SNPs or indels in the recently collected strain suggesting that most insertions have a very similar sequence ( Fig 2A ). This observation holds true when multiple old and young D. melanogaster strains are analysed ( S2 Fig ).
A phylogeny based on the reverse transcriptase domain of different TE families suggests that Spoink is a member of the gypsy/mdg3 superfamily/group of LTR retrotransposons ( Fig 1B ; [ 2 ]). As expected for members of the Ty3/gypsy superfamily, Spoink generates a target site duplication of 4 bp and it has an insertion motif enriched for ATAT ( Fig 1A ; [ 2 , 73 ]). A gag-pol polyprotein as encoded by Spoink was observed for some Ty3/gypsy transposons [ 74 , 75 ] but not for others [ 72 ]. However, Spoink differs from what is expected for the Ty3/gypsy superfamily in two ways. First, the predicted primer binding site of Spoink directly follows the LTR, whereas typically for Ty3/gypsy there is a shift of 5–8nt ( Fig 1A ; [ 2 ]). Second, the LTR motif is TG…TA which is different from the TG…CA motif usually reported for gypsy TEs [ 2 ].
A) Overview of the composition of Spoink. Features are shown in color and the alignments show the sequences around the main features of Spoink for two insertions in each of three different long-read assemblies of D. melanogaster. B) Phylogenetic tree based on the reverse-transcriptase domain of pol for Spoink and several other LTR retrotransposons. Multiple families have been picked for each of the main superfamilies/groups of LTR transposons [ 2 ]. Our data suggest that Spoink is a member of the gypsy/mdg3 group.
Spoink is an LTR retrotransposon with a length of 5216 bp and LTRs of 349 bp ( Fig 1A ; for coordinates of the analysed insertions see S3 Table ). At positions 4639–4700 Spoink contains a poly-A tract, which length may differ by a few bases between insertions. Spoink encodes a 695 aa putative gag-pol polyprotein. Ordered from the N- to the C-terminus, the conserved domains of the polyprotein are: reverse transcriptase of LTR (e-value = 2.2e − 59; CDD v3.20 [ 71 ]), RNase HI of Ty3/gypsy elements (e-value = 1.65e − 48;) and integrase zinc binding domain (e-value = 4.81e − 16). Spoink lacks an env. The order of these domains, with the integrase downstream of the reverse transcriptase, is typical for Ty3/gypsy transposons [ 72 ].
Previous work showed that at least seven TE families invaded D. melanogaster populations during the last two hundred years [ 21 , 29 , 31 ]. To explore whether additional, hitherto poorly characterised TEs could have invaded D. melanogaster, we investigated long-read assemblies of recently collected D. melanogaster strains [ 40 ] using a newly assembled repeat library [ 5 ]. Interestingly we found differences in the abundance of “gypsy_7_DEl” between the reference strain Iso-1 and more recently collected D. melanogaster strains ( S1 Table ). To better characterize this TE, we generated a consensus sequence based on the novel insertions and checked if this consensus sequence matches any of the repeats described in repeat libraries generated for D. melanogaster and related species [ 5 , 40 , 43 , 69 , 70 ]. A fragmented copy of this TE, with just one of the two LTRs being present, was reported by [ 40 ] (0.13% divergence; “con41_UnFmcl001_RLX-incomp”; S2 Table ). The next best hits were gypsy7 Del, gypsy2 DSim, micropia and Invader6 (18–30% divergence; S2 Table ). Given this high sequence divergence from previously described TE families and the fact that this novel TE belongs to an entirely different superfamily/group than gypsy7 (see below), we decided to give this TE a new name. We call this novel TE “Spoink” inspired by a Pokémon that needs to continue jumping to stay alive.
Discussion
Here we suggest that the LTR-retrotransposon Spoink invaded D. melanogaster populations between 1983 and 1993, after the spread of the P-element. Similarly to the P-element, the Spoink invasion was likely triggered by horizontal transfer from a species in the willistoni group. Horizontal transfer of a TE is usually inferred from three lines of evidence: i) a patchy distribution of the TE among closely related species, ii) a phylogenetic discrepancy between the TE and the host species and iii) a high similarity between the TE of the donor and recipient species, which is frequently quantified by the synonymous divergence of the TE [95, 96]. All of these three lines of arguments support a horizontal transfer of Spoink in D. melanogaster, with a species of the willistoni group being the likely donor. First we found a patchy distribution among species of the melanogaster group (for D. simulans we even have a patchy distribution among different strains; Fig 5A). Second Spoink insertions of D. melanogaster (and other species that may have gotten Spoink recently) are nested within species of the willistoni group (Fig 5B), a clear phylogenetic discrepancy. Third we found that the synonymous divergence of Spoink is lower than for all orthologous genes in D. melanogaster and D. willistoni (S9 Fig). In addition to this classical but indirect lines of evidence, we have however more direct and thus more compelling evidence for the horizontal transfer of Spoink. Based on strains collected during the last hundred years from all major geographic regions we showed that Spoink insertions were absent in all strains collected before 1983 but present in all strains collected after 1993 (using Illumina short read data, long-read assemblies, and PCR/Sanger sequencing). This makes Spoink one of the best documented cases of a recent horizontal transfer of a TE, similarly to the P-element where also strains collected during the last 100 years support the recent horizontal transfer [28, 29].
The abundance of sequencing data from strains collected at different time points during the last century allowed us to pinpoint the timing of the invasion in a way that would not have been previously possible. Spoink appears to have rapidly spread throughout global populations of D. melanogaster between 1983 and 1993. The narrow time-window of 10 years is plausible as studies monitoring P-element invasions in experimental populations showed that the P-element can invade populations within 20–60 generations [65, 97, 98]. Assuming that natural D. melanogaster populations have about 15 generations per year [99], a TE could penetrate a natural D. melanogaster population within 1–3 years. Given this potential rapidness of TE invasions it is likely that Spoink spread quickly between 1983 and 1993. Since there is a gap between strains sampled at 1983 and 1993 we cannot further narrow down the timing of the invasion. Furthermore, the strains used for timing the invasions were sampled from diverse geographic regions and Spoink likely spread at different times in different geographic regions. If horizontal transfer from a willistoni species triggered the invasion, as suggested by our data, then Spoink will have first spread in D. melanogaster populations from South America (the habitat of willistoni species), followed by populations from North America and the other continents. It is also feasible that Spoink invaded D. melanogaster indirectly, for example using D. simulans as intermediate host, in which case the Spoink invasion in D. melanogaster may have been triggered in almost any geographic region (both, D. simulans and D. melanogaster, are cosmopolitan species [100]). Unfortunately, we cannot infer the timing of the geographic spread of the Spoink invasion in different continents as D. melanogaster strains were not sampled sufficiently densely from different regions. Our work thus highlights the importance of efforts such as DrosEU, GDL and DrosRTEC to densely sample Drosophila strains in time and space [51, 101, 102]. It is also interesting to ask as to which extent human activity (e.g. trafficking of goods) contributed to the rapid spread of Spoink. Given that our analysis of the Spoink composition shows that geographically distant populations (Bejing/Ithaca or Netherlands/Zimbabwe) cluster together, human activity may have played a role. Increasing human activity could also explain why Spoink (invasion 1983–1993) seems to have spread faster than the P-element (1950–1980).
Our investigation of Spoink insertions in different drosophilid species suggests that the Spoink invasion in D. melanogaster was triggered by horizontal transfer from a species of the willistoni group. Although it is possible that we did not analyse the true donor species, we consider it unlikely to be a species outside of the willistoni group given the wide distribution of Spoink in all species in the willistoni group. In addition, the phylogenetic tree of Spoink has deep branches within the willistoni group, suggesting that Spoink is ancestral in this group (S10 Fig).
A related open question is when Spoink first entered D. melanogaster populations. Since a TE may initially solely spread in some isolated subpopulations there could be a considerable lag time between the horizontal transfer of a TE and its spread in worldwide population. The presence of Spoink in a strain collected around 1979 in Providence (USA; Fig 3B) could be due to this lag time (or contamination). Nevertheless, the horizontal transfer of Spoink must have happened between the spread of D. melanogaster into the habitat of the willistoni group, about 200 years ago, and the invasion of Spoink in worldwide populations between 1983 and 1993. In addition to the P-element, Spoink is the second TE that invaded D. melanogaster populations following horizontal transfer from a species of the willistoni group. Species from the willistoni group are very distantly related with D. melanogaster (about 100my [103]) and we were thus wondering whether it is a coincidence that a species of the willistoni group is again acting as donor of a TE invasion in D. melanogaster. The recent habitat expansion of D. melanogaster into the Americas resulted in novel contacts with many species, in addition to species of the willistoni group, that might have acted as donors of novel TEs such as D. pseudoobscura or D. persimilis [104]. Why is again a species of the willistoni group and not one of these other species acting as donor of a novel TE? Apart from mere chance, there are several, not mutually exclusive, hypotheses for this observation. First, it is feasible TEs of the willistoni group are exceptionally compatible with D. melanogaster at a molecular level. Second, some parasites targeting both D. melanogaster and species of the willistoni group could be efficient vectors for horizontal transfer of TEs. Third, the physical contact between D. melanogaster and some species of the willistoni group might be unusually tight, facilitating horizontal transfer of TEs by an unknown vector. D. willistoni is a common drosophilid in South American forests [105]. Habitat fragmentation caused by human deforestation may thus generate intensive contacts between human commensal species, such as D. melanogaster, and abundant forest species like D. willistoni. Fourth, species of the willistoni group might be exceptionally numerous resulting in elevated probability for horizontal transfer of a TE.
The Spoink invasion is the eighth TE invasion in D. melanogaster that has occurred during the last 200 year. As we argued previously, such a high rate of TE invasions is likely unusual during the evolution of the D. melanogaster lineage since the number of TE families in D. melanogaster is much smaller than what would be expected if this rate of invasions would persist [21]. It is possible that the high rate of TE invasions continues beyond the past 200 years since many LTR transposons in D. melanogaster are likely of very recent origin (possibly < 16.000years [85, 106]). One possible explanation for this high rate of recent TE invasions is that human activity contributed to the habitat expansion of D. melanogaster. Due to this habitat expansion D. melanogaster spread into the habitat of D. willistoni which enabled the horizontal transfer of Spoink. This raises the possibility that other species with recent habitat expansions also experienced unusually high rates of TE invasions. It is also interesting to ask whether the rate of TE invasions differs among species. For example cosmopolitan species, such as D. melanogaster, may generally experience higher rates of horizontal transfer than more locally confined species. The cosmopolitan distribution will bring species into contact with many diverse species, thereby increasing the opportunities for horizontal transfer of a TE.
The Spoink invasions also opens up several novel opportunities for research. First, the broad availability of strains with and without Spoink will enable testing whether Spoink activity induces phenotypic effects, similarly to hybrid dysgenesis described for the P-element, I-element and hobo, but not for Tirant [31, 107–109]. Second, it will be interesting to investigate whether some Spoink insertions participated in rapid adaptation of D. melanogaster populations, similar to a P-element insertion which contribute to insecticide resistance [110]. Third, it will enable studying Spoink invasions in experimental populations, shedding light on the dynamics of TE invasions, much as other recent studies investigating the invasion dynamics of the P-element [97, 98, 111]. Fourth, investigation into the distribution of species that have been infected with Spoink will shed light on the networks of horizontal transfer in drosophilid species. Fifth, the Spoink invasion provides an opportunity to study the establishment of the piRNA-based host defence [similar to [24, 65]]. For example we found that none of the piRNA cluster insertions are shared between individuals, suggesting there is no or solely weak selection for piRNA cluster insertions. Furthermore we found an extremely heterogeneous abundance of Spoink insertions in piRNA clusters where we could not find a single cluster insertions of Spoink in several strains. It is an important open question whether such a heterogeneous distribution is compatible with the trap model [83]. One possibility is that a few cluster insertions in populations are sufficient to trigger the paramutation of regular (non-paramutated) Spoink insertions into piRNA producing loci [16, 112, 113]. These paramutated Spoink insertions may then compensate for the low number of Spoink insertions in piRNA-clusters [112]. Paramutations could thus explain why several studies found that stand-alone insertions of TEs can nucleate their own piRNA production [69, 83, 114, 115].
The war between transposons and their hosts is constantly raging, with potentially large fitness effects for the individuals in populations. Over the last two hundred years there have been at least eight invasions of TEs into D. melanogaster, each of which could disrupt fertility for example by inducing some form of hybrid dysgenesis. TEs are responsible for > 80% of visible spontaneous mutations in D. melanogaster, and produce more variation than all SNPs combined [116–118]. In the long read assemblies considered here, more than half of insertions of Spoink were into genes [40]. The recent Spoink invasion could thus have a significant impact on the evolution of D. melanogaster lineage.
[END]
---
[1] Url:
https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1011201
Published and (C) by PLOS One
Content appears here under this condition or license: Creative Commons - Attribution BY 4.0.
via Magical.Fish Gopher News Feeds:
gopher://magical.fish/1/feeds/news/plosone/
