(C) PLOS One
This story was originally published by PLOS One and is unaltered.
. . . . . . . . . .
Precise coordination between nutrient transporters ensures fertility in the malaria mosquito Anopheles gambiae [1]
['Iryna Stryapunina', 'Harvard T.H. Chan School Of Public Health', 'Boston', 'Massachusetts', 'United States Of America', 'Maurice A. Itoe', 'Queenie Trinh', 'Charles Vidoudez', 'Harvard Center For Mass Spectrometry', 'Cambridge']
Date: 2024-02
Abstract Females from many mosquito species feed on blood to acquire nutrients for egg development. The oogenetic cycle has been characterized in the arboviral vector Aedes aegypti, where after a bloodmeal, the lipid transporter lipophorin (Lp) shuttles lipids from the midgut and fat body to the ovaries, and a yolk precursor protein, vitellogenin (Vg), is deposited into the oocyte by receptor-mediated endocytosis. Our understanding of how the roles of these two nutrient transporters are mutually coordinated is however limited in this and other mosquito species. Here, we demonstrate that in the malaria mosquito Anopheles gambiae, Lp and Vg are reciprocally regulated in a timely manner to optimize egg development and ensure fertility. Defective lipid transport via Lp knockdown triggers abortive ovarian follicle development, leading to misregulation of Vg and aberrant yolk granules. Conversely, depletion of Vg causes an upregulation of Lp in the fat body in a manner that appears to be at least partially dependent on target of rapamycin (TOR) signaling, resulting in excess lipid accumulation in the developing follicles. Embryos deposited by Vg-depleted mothers are completely inviable, and are arrested early during development, likely due to severely reduced amino acid levels and protein synthesis. Our findings demonstrate that the mutual regulation of these two nutrient transporters is essential to safeguard fertility by ensuring correct nutrient balance in the developing oocyte, and validate Vg and Lp as two potential candidates for mosquito control.
Author summary Female mosquitoes bite humans to acquire nutrients for egg development. The shuttling of nutrients from the gut (where the blood is digested) to the ovaries (where eggs are produced) relies on several nutrient transporters to move through the mosquito circulation, including Lipophorin (Lp), a fat transporter expressed early and Vitellogenin (Vg), a large protein expressed later that transports amino acids. We know relatively little of how these two nutrient transporters are successfully coordinated in any mosquito species, so we undertook to examine their interplay in the Anopheles malaria mosquito. We found that without Lp expression, Vg is incorrectly distributed within ovarian follicles and egg production is aborted, whereas without Vg, fat transport by Lp is not switched off in a timely manner. This results in excess fat and minimal protein deposition in eggs, rendering females completely infertile. We also find evidence that the mutual regulation of these transporters may be mediated by TOR signaling. As well as providing further insight into the regulation of essential reproductive processes, these results may aid in the development of malaria control strategies that aim to reduce the size of mosquito populations.
Citation: Stryapunina I, Itoe MA, Trinh Q, Vidoudez C, Du E, Mendoza L, et al. (2024) Precise coordination between nutrient transporters ensures fertility in the malaria mosquito Anopheles gambiae. PLoS Genet 20(1): e1011145.
https://doi.org/10.1371/journal.pgen.1011145 Editor: Takaaki Daimon, Kyoto University: Kyoto Daigaku, JAPAN Received: July 27, 2023; Accepted: January 20, 2024; Published: January 29, 2024 Copyright: © 2024 Stryapunina et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability: The numerical data are provided in the Supporting Information and are accessible from the Harvard Dataverse online repository using the link
https://doi.org/10.7910/DVN/C5UOZS. Funding: F.C. is funded by the Howard Hughes Medical Institute (HHMI) as an HHMI investigator (www.hhmi.org), and by the National Institutes of Health (NIH) (R01AI148646, R01AI153404, www.nih.gov). I.S. is funded by Natural Sciences and Engineering Research Council of Canada (NSERC, www.nserc-crsng.gc.ca) as a postgraduate scholarship recipient (PGSD3 - 545866 - 2020). M.I. is funded by Charles A. King Trust postdoctoral research fellowship in basic science from Health Resources in Action (HRiA, www.hria.org). The findings and conclusions within this publication are those of the authors and do not necessarily reflect positions or policies of the HHMI or the NIH. The funders had no role in the study design, in data collection, analysis or interpretation, in the decision to publish, or the preparation of the manuscript. Competing interests: The authors have declared that no competing interests exist.
Introduction The Anopheles gambiae mosquito is one of the most important vectors for the transmission of Plasmodium falciparum, a malaria parasite that causes remarkable morbidity and mortality in sub-Saharan Africa and other tropical and subtropical regions [1]. Transmission starts when a female mosquito takes a blood meal from a human infected with the sexual stages of Plasmodium. At the same time as parasite development begins in the midgut, females use blood nutrients to start their reproductive cycle, which culminates in the development of a full set of eggs in about 2–3 days. The signalling cascades triggered by blood feeding and leading to successful egg development have been largely elucidated in Aedes aegypti mosquitoes. In this species, the ovarian ecdysteroidogenic hormone (OEH) and insulin-like peptides (ILPs) are released from the brain upon blood feeding, stimulating the production of the ecdysteroid ecdysone (E, which is synthetized from cholesterol) by the ovarian epithelium [2,3]. After transport to the fat body, E is converted to 20-hydroxyecdysone (20E, the active form of this steroid hormone), which binds to its nuclear receptor to trigger transcriptional cascades leading to the activation and repression of hundreds of genes. Among these genes is Vitellogenin (Vg), the main egg yolk protein precursor in oviparous species, which is transcribed in the fat body, peaking in production at 24 hours (h) post blood meal (PBM) [4]. After translation, Vg is then released from the fat body into the hemolymph, from where it is taken up by the ovaries by receptor-mediated endocytosis [5,6]. In the oocytes Vg is crystalized into vitellin, which forms the yolk bodies that the embryo uses as a nutritional source of amino acids [7–9]. Prior to Vg expression, the lipid transporter lipophorin (Lp) shuttles cholesterol and neutral lipids (mostly triglycerides [10]) from the midgut to the ovaries, starting the early phase of egg development [11,12]. It is unclear how Lp expression is regulated, although ex vivo experiments in Ae. aegypti have shown this lipid transporter to be upregulated upon fat body exposure to 20E [11]. After egg development is completed, if the female is mated, she will oviposit her eggs and return to the pre-blood meal metabolic state. At this point she is ready to begin another gonotrophic cycle, consisting of blood feeding, oogenesis and oviposition. Besides triggering the synthesis of 20E through cholesterol uptake and E release by the ovaries, blood meal digestion and the subsequent influx of amino acids and ILPs results in the activation of the target of rapamycin (TOR) signalling pathway [4,13]. The integration of these nutritional signals leads to a TOR-mediated global regulation of translation and transcription of specific genes that control growth and metabolism [14], including Vg transcription in Ae. aegypti mosquitoes [15], reviewed in [4,13]. TOR regulates translation by directly phosphorylating S6 kinase (S6K) [16], which in turn phosphorylates S6, thus regulating translation of ribosomal proteins and translation elongation factors (reviewed in [4,13]). S6K also activates the translation of AaGATAa, which promotes Vg transcription in Ae. aegypti [17]. Due to its central role in the integration of nutritional signals post blood meal, abrogation of TOR signalling results in reduced fecundity in Ae. aegypti and Anopheles stephensi [15,16,18,19]. Although successful oogenesis in mosquitoes is likely to be tightly dependent on the coordinated function of Lp and Vg, very limited information is available concerning whether and how these nutrient transporters are mutually regulated to ensure egg development and fertility. A study conducted in An. gambiae showed that Lp knockdown results in reduced expression of Vg after feeding on mice infected with the rodent malaria parasite Plasmodium berghei, while Vg depletion did not affect Lp expression [20]. No further studies have clarified the possible co-regulation of these factors in ensuring accurate nutrient deposition during oogenesis. Additionally, data concerning the mechanisms regulating egg development in An. gambiae are sparce despite the key importance of this species for malaria transmission. In these mosquitoes, knockdown of Lp (whose expression peaks at 12–18h PBM) has been shown to severely hamper egg development [20–22], revealing a similar role to Aedes. Interestingly, Lp levels were upregulated upon inhibition of 20E signalling via depletion of the nuclear EcR receptor, suggesting that in certain conditions 20E may repress its expression [22]. The role of Vg in An. gambiae reproduction has been studied even more marginally, with a single study reporting that its depletion results in fewer females developing mature oocytes [20]. Here we show that the functions of Lp and Vg are tightly linked in An. gambiae. Using functional knockdowns of these genes combined with electron microscopy, multi-omics and biochemistry analyses, we show that depletion of these factors results in profoundly deleterious effects on fecundity and fertility. While Lp is required for successful egg development, Vg is essential for fertility as its depletion leads to an early block in embryonic development. We also prove that the functions of these factors are mutually co-regulated, as Lp is needed for the correct incorporation of Vg in the developing oocytes while Vg’s utilization of amino acids is required to terminate the Lp-mediated accumulation of lipids in the ovaries. Intriguingly, our data suggest that both induction of Vg after blood feeding and its downstream effects on Lp are mediated by TOR signalling, which in turn appears to be repressed by Vg following a blood meal. Our data reveal an intricate reproductive system based on the timely and mutually coordinated function of these nutrient transporters, and identify novel potential targets to interfere with the fertility of these important malaria vectors.
Discussion Blood feeding is an essential process for the survival of mosquito species that, like An. gambiae, rely on blood nutrients for oogenesis. After a blood meal, different nutrient transporters start shuffling cholesterol, lipids and proteins from the midgut and fat body to the ovaries, and the individual roles of two of these factors, Lp and Vg, had been previously determined. There remained, however, important outstanding questions concerning whether and how these two essential transporters are co-regulated in order to ensure reproductive success. How do mosquitoes balance acquisition of different nutrients by the ovaries? What are the signals that limit lipid accumulation and that trigger vitellogenesis? Moreover, knowledge concerning Lp and Vg functions and their regulation in Anopheles as opposed to Aedes was only marginal. Here, we show that in these mosquitoes, oogenesis is the product of a precise and intricate interplay between these two factors (S5 Fig). The initial phase of oocyte development is dominated by Lp, which incorporates lipids (mostly triglycerides) and cholesterol into ovaries triggering their growth. During this early phase, as E is converted to 20E in the fat body, this steroid hormone triggers the expression of Vg, which peaks at 24h PBM and provides the oocytes with considerable stores of amino acids. When Lp expression is impaired, 20E levels are unchanged (S1F Fig) and yet egg development is strikingly reduced (Fig 1A), Vg localization and accumulation is affected (Fig 1C), and yolk bodies are aberrant (Fig 1D). Upon Lp depletion Vg seems to be retained in the fat body, since the ovaries are degenerating and cannot accumulate further yolk (S1D Fig). These findings suggest that correct lipid accumulation is an early check point that mosquitoes use to decide whether to proceed with vitellogenesis. Reducing Vg expression levels, on the other hand, leads to increased Lp expression (Fig 2F and 2G) and a surplus of glycerides in the ovaries (Fig 2E), which suggests that Vg synthesis is the signal that prevents excessive lipid trafficking by Lp into the oocytes. Interestingly, in another study Vg knockdown did not appear to affect Lp expression in An. gambiae females fed on mice infected with P. berghei parasites [20]. This discrepancy with our results may indicate that rodent malaria parasites, which are known to inflict severe reproductive costs in infected mosquito females [28], affect the normal accumulation of lipids during the oogenetic process, although other factors such as differences in temperature (infections with P. berghei are done at permissive temperatures around 20°C compared to standard mosquito rearing conditions of 28°C) cannot be excluded. Strikingly, knockdown of Vg led to complete infertility. This phenotype was so penetrant that we confirmed it with a dsRNA second construct targeting a different region of the gene to rule out a possible unspecific effect of the first construct. This effect is reminiscent of observations in other insects, where altering Vg gene copy number, expression or internalization leads to complete sterility or decreased hatch rate by as yet unknown mechanisms [29–37]. Understanding how embryonic lethality is induced may lead to novel ideas for the design of mosquito-targeted interventions, so we set out to determine the mechanisms behind death. As Vg is also expressed in the female spermatheca after mating [38, 39] we initially thought that its depletion may have caused irreversible damage to sperm. The observation that eggs are fertilized and embryos start undergoing nuclear division (Fig 4A), however, appears to discount this possibility. Another potential explanation is that the improper deposition of lipid in the oocyte causes embryonic lethality, but based on our metabolomics analysis, a more plausible hypothesis is that lethality is a result of amino acid starvation. We show that embryos from Vg-depleted females are significantly deficient in 14 of the 19 identified amino acids, which results in a lack of building blocks for translation and thus development (S1 Table). It is plausible to speculate that depletion in these essential nutrients may activate the amino acid starvation response pathway, triggering a global shutdown of translation that may lead to apoptosis, compatible with our observation of nuclei blebbing in those embryos [40–42]. Our data using rapamycin suggest that the An. gambiae Vg is regulated by TOR (Fig 3A), as was previously shown in Ae. aegypti [15]. Surprisingly, however, our findings also suggest that Vg expression leads to suppressed TOR signaling, as upon Vg knockdown S6K phosphorylation was strongly upregulated possibly due to an increase in free amino acids (Figs 3B and S3F). This upregulation in TOR signaling also resulted in an increase in Lp transcription and translation, further shedding light on regulation of Lp expression. Previous studies had shown that Lp levels in An. gambiae are under steroid hormone control, as impairing 20E signaling caused an increase in Lp transcription at 24h, 36h and 48h PBM [22]. Since Vg is under 20E control, it is probable that the result observed by Werling et al. at 24h PBM (increased Lp expression in dsEcR) is mediated by reduced Vg expression/increased TOR signaling, while additional EcR-controlled mediators, or EcR itself, are responsible for the decreased Lp expression at later timepoints. With the caveat that our current results were obtained only by using the inhibitor rapamycin rather than by also depleting key components of the TOR pathway, these combined observations may suggest that TOR and 20E signaling exert opposite effects on Lp expression—with 20E repressing its levels and TOR enhancing them, an intriguing finding that deserves more thorough investigation in future studies. Compatible with our data, the Lp promoter has putative GATA transcription factor binding motifs, some of which are known to be regulated by TOR signaling [17,43]. Does the interplay between Lp and Vg also affect the development of P. falciparum parasites? An earlier study showed that following Lp knockdown in An. gambiae, P. falciparum oocyst numbers are decreased [22]. No other effects were detected on parasite development, unlike in the mouse malaria parasite P. berghei where Lp depletion, besides a decrease in oocyst numbers, also led to reduced oocyst growth [20]. While the role of Vg in P. falciparum has not been directly determined, it is known that impairing 20E signaling (which in turn negatively affects Vg levels) has profound and opposite effects on parasites, as it reduces parasite numbers but accelerates their growth. Regardless of its impact on parasite development, our data reveal the interplay between Lp and Vg as essential for mosquito fertility, opening the possibility of targeting it to reduce the reproductive success of mosquito populations.
Materials and methods Mosquito lines and rearing G3 Anopheles gambiae mosquitoes were reared at 27°C, 70–80% humidity. Adults were fed 10% glucose solution and purchased human blood (Research Blood Components, Boston, MA). Females and males were separated by pupae sexing, and females were kept separate to ensure virgin status or mixed with males at a 1:2 ratio for fertility experiments and egg collections. dsRNA generation A 816bp LacZ fragment and 600bp Lp (AGAP001826) fragment were generated from plasmids pLL100-LacZ and pLL10-Lp as described previously [22, 44, 45] using T7 primer (5’–TAATACGACTCACTATAGGG–3’). A 552 bp fragment of Vg (AGAP004203) corresponding to bases 3374–3925 of the Vg cDNA was amplified from plasmid pLL10-Vg, a gift from Miranda Whitten and Elena A. Levashina (Max Planck Institute for Infection Biology, Berlin), using a primer matching the inverted T7 promoters (same as above). To generate the dsVg #2 construct, a 284bp PCR product was generated from An. gambiae Vg cDNA (AGAP004203) corresponding to bases 4530–4813 using forward primer 5’–ATTGGGTACCGGGCCCCCCCGCACGTCTCGATGAAGGGTA–3’ and reverse primer 5’–GGGCCGCGGTGGCGGCCGCTCTAGACCTGCCCTGGAAGAAGTAGTCC–3’. The pLL10-Vg backbone and the PCR fragment were restriction digested with XbaI and XhoI, separated on an agarose gel and gel purified. Then, fragments were assembled using NEBuilder HiFi DNA Assembly Kit. PCR product was amplified using T7 primer. A 495 bp eGFP fragment was amplified from plasmid pCR2.1-eGFP using pCR2.1-T7F: 5’–taatacgactcactatagggCCGCCAGTGTGCTGGAA–3’ and pCR2.1-T7R: 5’–taatacgactcactatagggGGATATCTGCAGAATTCGCCC–3’ as described previously [46]. PCR for dsRNA generation was separated by gel electrophoresis for size confirmation, and transcribed into dsRNA by in vitro transcription Megascript T7 kit (ThermoFisher Scientific) [22]. dsRNA was purified by phenol-chloroform extraction, and diluted to 10 μg/μL. dsRNA injections Females on day 1 post eclosion were injected with 69 nL of dsRNA (dsLacZ, dsVg, dsVg #2, dsLp dsGFP) using Nanoject III (Drummond), and allowed to recover. Surviving females were fed with blood 3 days post injection. Unfed females were removed from experimental cages. Egg counts Virgin females were dissected 3–7 days PBM, and the egg clutches were counted. Although eggs take 2–3 days to fully develop after blood feeding, virgin females do not oviposit their eggs, and once developed, the number of eggs does not change from day 3 to 7 PBM in our laboratory conditions, making it possible to count egg numbers even at 7 days PBM. Fertility assay Injected females were mixed with males at a 1:2 ratio immediately after injection, and blood fed three days later. One day after blood feeding, fed females were moved to individual cups with around 2cm of water at the bottom. Hatched and unhatched eggs from every cup were counted within a week. RNA extraction, cDNA synthesis and RT-qPCR Fat bodies or heads (10 tissues per tube) from female mosquitoes were dissected in PBS and stored at -80°C in 300 μL TRI Reagent (ThermoFisher Scientific). Samples were thawed and bead beaten using 2 mm beads. Then RNA was extracted using manufacturer’s instructions with a modification to wash the RNA pellet using 70% ethanol. 2.5 μg of RNA was aliquoted and DNase treated with Turbo DNase from the TURBO DNA-free Kit (ThermoFisher Scientific), followed by DNase inactivation from the same kit. cDNA synthesis was carried out in 100 μL reactions using random primers (ThermoFisher Scientific), dNTPs (ThermoFisher Scientific), first strand buffer (VWR), RNAseOUT (ThermoFisher Scientific) and MMLV (ThermoFisher Scientific) [22]. Relative quantification RT-qPCR was carried out using SYBR-Green mix and primers from S4 Table. Primers were designed on exon-exon junctions where possible. Quantification was performed in triplicate using the QuantStudio 6 Pro qPCR machine (ThermoFisher Scientific). Rpl19 was used as the endogenous control for relative quantification. Ecdysteroid level measurement Ten females at 26h PBM were collected per sample by removing their heads and storing them in 400 μL of 100% methanol at -80°C. Ecdysteroids were measured using the 20E enzyme immunoassay kit (Cayman Chemical), according to manufacturer instructions and as described in previously published work [22]. Although the kit is targeted at identifying 20E, the immunoassay cross-reacts with other ecdysteroids. Hence, the measurements in S2 Fig are labelled as “Ecdysteroid levels”. Immunofluorescence microscopy and tissue staining Ovaries were dissected from females at specified timepoints and incubated at room temperature in 4% paraformaldehyde (PFA) for 30 minutes, followed by 3 washes in PBS for 15 minutes. Ovaries were permeabilized and blocked with 0.1% Triton X-100 and 1% bovine serum albumin (BSA) in PBS for 1h followed by 3 washes in PBS for 15 minutes. Ovaries were then incubated with DAPI and LD540 [47], both at a concentration of 1 μg/mL, at room temperature for 15 minutes. After staining, ovaries were washed in PBS 3 times for 15 minutes and mounted using Vectashield mounting medium (Vector Laboratories). Images were captured on a Zeiss Inverted Observer Z1. Embryo collections for microscopy An egg bowl was inserted into cages of mated females blood fed 96h before. The egg bowl was removed 2h later, and embryos were collected 3h later, resulting in a timepoint of 3–5h. Embryos were dechorionated and cracked as described previously [48]. Briefly, embryos were washed with 25% household bleach (2% sodium hypochlorite final concentration) in 1xPBS, collected into glass vials with 9% PFA and heptane, and rotated for 25 minutes. PFA was removed and replaced with deionized water twice. Vials were shaken for another 30 minutes. Then water was replaced with boiling water and incubated in a hot water bath for 30 seconds, and immediately replaced with ice cold water. Both water and heptane were removed and replaced with heptane and methanol. Embryos were swirled vigorously to crack the shell, washed 3 times with methanol and collected into methanol. Embryos were then coaxed out of eggshells [49], and stained with DAPI as described above. Transmission electron microscopy Dissected mosquito ovaries were collected in 200 uL of fixative (2.5% paraformaldehyde, 5% glutaraldehyde, 0.06% picric acid in 0.2M cacodylate buffer) and spun down briefly to fully submerge the tissues in fixative. Fixed samples were submitted to the Harvard Medical School Electron Microscopy Core. Samples were washed once in 0.1M cacodylate buffer, twice in water, and then postfixed with 1% osmium tetroxide/1.5% potassium ferrocyanide in water for 1h. Samples were then washed twice in water followed by once in 50 mM maleate buffer pH 5.15 (MB). Next, the samples were incubated for 1h in 1% uranyl acetate in MB, followed by one wash in MB, and two washes in water. Samples were then subjected to dehydration via an increasing ethanol gradient (50%, 70%, 90%, 100%, 100% ethanol) for 10 minutes each. After dehydration, samples were placed in propylene oxide for 1h and then infiltrated overnight in a 1:1 mixture of propylene oxide and TAAB 812 Resin (
https://taab.co.uk/, #T022). The following day, samples were embedded in TAAB 812 Resin and polymerized at 60°C for 48h. Ultrathin sections (roughly 80 nm) were cut on a Reichert Ultracut-S microtome, sections were picked up onto copper grids, stained with lead citrate and imaged in a JEOL 1200EX transmission electron microscope equipped with an AMT 2K CCD camera. Rapamycin treatment Rapamycin was dissolved in DMSO at 10 mM. DMSO-Rapamycin solution was then mixed with acetone as a volatile carrier with the final concentrations being 40 μM rapamycin and 2.4% DMSO (v/v). 0.5 μL was topically applied to the posterior thoraces of females on ice at 2h PBM. Control mosquitoes were treated with 0.5 μL of 2.4% DMSO in acetone. Acetone was used as a volatile carrier to ensure even delivery of the compound through the cuticle. Mosquitoes were placed into cages with 10% glucose to recover. Hemolymph collections For amino acid assay, hemolymph was collected by making a tear between the last and second-to-last segments on the abdomen, and injecting 2 μL of purified deionized water into each mosquito. A drop of liquid was collected from the abdomen with a pipette. Hemolymph from five females was pooled for the amino acid assay. Primary antibodies Antibody against Vg was generated with Genscript by injecting a rabbit with a Vg peptide (QADYDQDFQTADVKC). Rabbit serum was affinity purified to produce a polyclonal antibody used at 1:1000 for Western blotting. Anti-Lp antibody was also generated with Genscript using the following peptide: FQRDASTKDEKRSGC [22]. This antibody was used at 1:4000 for Western blotting. Anti-actin antibody was acquired from Abcam (MAC237) and used at a dilution of 1:4000. Phospho-S6K antibody was acquired from MilliporeSigma (07-018-I) and used at a dilution of 1:1000. Western blotting 5 tissues per sample, or 40 embryos were collected into 55 μL of PBS with protease and phosphatase inhibitors (cOmplete Mini EDTA free protease inhibitor cocktail, Halt phosphatase inhibitor). DTT (200 mM) and NuPAGE LDS Sample Buffer were added. Tissues were bead beaten and boiled for 10 minutes. Then, 1/10th of the sample was loaded onto either a NuPAGE 4–12% Bis-Tris gel or NuPAGE 3–8% Tris Acetate gel (when blotting for Lp). Gels were transferred for 10 minutes at 22V using an iBlot2 machine and iBlot2 PVDF Stacks, blocked in Intercept Blocking Buffer (LI-COR) for 1h, and then incubated with antibody overnight at 4°C. Membranes were washed with PBS-T 4 times for 5 minutes, and incubated with LI-COR secondary antibodies (Goat anti-Rat 680LT; Donkey anti-Rabbit 800CW) for 1–2h. Membranes were washed again with PBS-T 4 times and once in PBS. Membranes were imaged using a LI-COR developer. Western blot bands were quantified using ImageJ, with pixel intensities being normalized to the loading control (actin) as well as background. During embryonic development, actin levels rapidly change, so for embryo samples, Lp and Vg were normalized only to background. Triglyceride assay and Bradford assay Three tissues per sample were collected into NP40 Assay Reagent, and Triglyceride Colorimetric Assay was performed according to manufacturer’s instructions (Cayman Chemical). Briefly, tissues were homogenized by bead beating in 32 μL of the NP40 Assay Reagent, centrifuged at 10,000g for 10 minutes. 10 μL of supernatant was added to 150 μL of Enzyme Mixture in duplicate and incubated for 30 minutes at 37°C. Absorbance was measured at 530 nm. Of note, the kit releases glycerol from triglycerides and measures glycerol levels, and does not measure triglyceride levels directly. The same supernatant was also used for Bradford assay. Supernatant was diluted 1 in 10 and 4 μL of diluted supernatant was added to 200 μL of Bradford reagent (Bio-Rad) at room temperature, and absorbance was recorded at 595 nm. Amino acid assay Five tissues per sample were collected into 50 μL of Ultrapure Distilled Water (Invitrogen), and amino acid assay was performed according to manufacturer’s instructions (EnzyChrom L-Amino Acid Assay Kit ELAA-100). Briefly, samples were homogenized by bead beating and centrifuged at 10,000g for 15 minutes. 20 μL of supernatant was mixed with Working Reagent in duplicate and incubated at room temperature for 60 minutes. Absorbance was recorded at 570 nm.
Metabolomics and lipidomics Sample collection 200 embryos were collected into 1 mL of methanol and homogenized by bead beating with five 2 mm glass beads, then transferred to 8 mL glass vials. Tubes were then rinsed with 1 mL of methanol that was pooled with the homogenized sample, and 4 mL of cold chloroform was added to the glass vials, which were then vortexed for 1 minute. 2 mL of water was added and glass vials were vortexed for another minute. Vials were then centrifuged for 10 minutes at 3000 g. The upper aqueous phase was submitted for metabolomics, and lower chloroform phase was submitted for lipidomics to the Harvard Center for Mass Spectrometry. Metabolomics mass spectrometry Samples were dried down under Nitrogen flow and resuspended in 25 μL of acetonitrile 30% in water. Ten microliter of each sample was used to create a pool sample for MS2/MS3 data acquisition. Samples were analyzed by LC-MS on a Vanquish LC coupled to an ID-X MS (Thermofisher Scientific). Five μL of sample was injected on a ZIC-pHILIC peek-coated column (150 mm x 2.1 mm, 5 μm particles, maintained at 40°C, SigmaAldrich). Buffer A was 20 mM Ammonium Carbonate, 0.1% Ammonium hydroxide in water and Buffer B was Acetonitrile 97% in water. The LC program was as follow: starting at 93% B, to 40% B in 19 min, then to 0% B in 9 min, maintained at 0% B for 5 min, then back to 93% B in 3 min and re-equilibrated at 93% B for 9 min. The flow rate was maintained at 0.15 mL min-1, except for the first 30 seconds where the flow rate was uniformly ramped from 0.05 to 0.15 mL min-1. Data was acquired on the ID-X in switching polarities at 120000 resolution, with an AGC target of 1e5, and a m/z range of 65 to 1000. MS1 data was acquired in switching polarities for all samples. MS2 and MS3 data was acquired on the pool sample using the AquirX DeepScan function, with 5 reinjections, separately in positive and negative ion mode. Data was analyzed in Compound Discoverer software (CD,version 3.3 Thermofisher Scientific). Identification was based on MS2/MS3 matching with a local MS2/MS3 mzvault library and corresponding retention time built with pure standards (Level 1 identification), or on mzcloud match (level 2 identification). Compounds where the retention time and the accurate mass matched an available standard, but for which MS2 data was not acquired are labelled MasslistRT matches. Each match was manually inspected. Metabolomics heatmap was generated using Metaboanalyst 5.0 by log 10 transforming the area under the curve values for metabolites identified as described above. Lipidomics mass spectrometry Samples were dried down under Nitrogen flow and resuspended in 60 μL of chloroform. LC–MS analyses were modified from [50] and were performed on an Orbitrap QExactive plus (Thermo Scientific) in line with an Ultimate 3000 LC (Thermo Scientific). Each sample was analyzed separately in positive and negative modes, in top 5 automatic data dependent MSMS mode. Twenty μL of sample was injected on a Biobond C4 column (4.6 × 50 mm, 5 μm, Dikma Technologies, coupled with a C4 guard column). Flow rate was set to 100 μl min−1 for 5 min with 0% mobile phase B (MB), then switched to 400 μl min−1 for 50 min, with a linear gradient of MB from 20% to 100%. The column was then washed at 500 μl min−1 for 8 min at 100% MB before being re-equilibrated for 7min at 0% MB and 500 μl min−1. For positive mode runs, buffers consisted for mobile phase A (MA) of 5 mM ammonium formate, 0.1% formic acid and 5% methanol in water, and for MB of 5 mM ammonium formate, 0.1% formic acid, 5% water, 35% methanol in isopropanol. For negative runs, buffers consisted for MA of 0.03% ammonium hydroxide, 5% methanol in water, and for MB of 0.03% ammonium hydroxide, 5% water, 35% methanol in isopropanol. Lipids were identified and integrated using the Lipidsearch software (version 4.2.27, Mitsui Knowledge Industry, University of Tokyo). Integrations and peak quality were curated manually before exporting and analyzing the data in Microsoft Excel. Quantification and statistical analyses All statistical tests were performed in GraphPad Prism 9.0 and JMP 17 Pro statistical software. The number of replicates and statistical tests performed are mentioned in the figure legend. Detailed outputs of statistical models and numerical data are provided in the supporting information (S5–S7 Tables). Residual Maximal Likelihood (REML) variance components analysis was used by fitting linear mixed models after data transformation to resemble normality. dsRNA treatment and timepoint were included as fixed effects and replicate as a random effect. If transformation was not possible, a generalized linear model was used instead. Interaction terms were removed when not significant and models with lower AICc scores were kept. Multiple comparisons were calculated using pairwise Student’s t-tests at each timepoint followed by FDR correction at a 0.05 significance level.
Acknowledgments We thank Kate Thornburg, Emily Selland, Elizabeth Nelson, Kaileigh Bumpus, and Aaron Stanton for rearing mosquitoes used in this study. We thank all other members of the Catteruccia lab for their ideas and feedback, as well as Krystle Kalafut for her insights on TOR signalling. We thank Christoph Thiele for providing the LD540 stain. Electron Microscopy Imaging, consultation and services were performed in the HMS Electron Microscopy Facility, and we thank Maria Ericsson, Peg Coughlin, and Anja Nordstrom for their help.
[END]
---
[1] Url:
https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1011145
Published and (C) by PLOS One
Content appears here under this condition or license: Creative Commons - Attribution BY 4.0.
via Magical.Fish Gopher News Feeds:
gopher://magical.fish/1/feeds/news/plosone/