(C) PLOS One
This story was originally published by PLOS One and is unaltered.
. . . . . . . . . .



Highlighter: An optogenetic system for high-resolution gene expression control in plants [1]

['Bo Larsen', 'Sainsbury Laboratory', 'University Of Cambridge', 'Cambridge', 'United Kingdom', 'Roberto Hofmann', 'Ines S. Camacho', 'Biometrology', 'Chemical', 'Biological Sciences Department']

Date: 2023-09

Abstract Optogenetic actuators have revolutionized the resolution at which biological processes can be controlled. In plants, deployment of optogenetics is challenging due to the need for these light-responsive systems to function in the context of horticultural light environments. Furthermore, many available optogenetic actuators are based on plant photoreceptors that might crosstalk with endogenous signaling processes, while others depend on exogenously supplied cofactors. To overcome such challenges, we have developed Highlighter, a synthetic, light-gated gene expression system tailored for in planta function. Highlighter is based on the photoswitchable CcaS-CcaR system from cyanobacteria and is repurposed for plants as a fully genetically encoded system. Analysis of a re-engineered CcaS in Escherichia coli demonstrated green/red photoswitching with phytochromobilin, a chromophore endogenous to plants, but also revealed a blue light response likely derived from a flavin-binding LOV-like domain. We deployed Highlighter in transiently transformed Nicotiana benthamiana for optogenetic control of fluorescent protein expression. Using light to guide differential fluorescent protein expression in nuclei of neighboring cells, we demonstrate unprecedented spatiotemporal control of target gene expression. We implemented the system to demonstrate optogenetic control over plant immunity and pigment production through modulation of the spectral composition of broadband visible (white) light. Highlighter is a step forward for optogenetics in plants and a technology for high-resolution gene induction that will advance fundamental plant biology and provide new opportunities for crop improvement.

Citation: Larsen B, Hofmann R, Camacho IS, Clarke RW, Lagarias JC, Jones AR, et al. (2023) Highlighter: An optogenetic system for high-resolution gene expression control in plants. PLoS Biol 21(9): e3002303. https://doi.org/10.1371/journal.pbio.3002303 Academic Editor: Mark Estelle, University of California San Diego, UNITED STATES Received: October 5, 2022; Accepted: August 18, 2023; Published: September 21, 2023 Copyright: © 2023 Larsen et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability: All relevant data are within the paper and its Supporting Information files. Funding: We thank the Gatsby Charitable Foundation (https://www.gatsby.org.uk) for funding support of BL, RH and AMJ. BL and AMJ also received funding support from the European Research Council (https://erc.europa.eu) under the European Union’s Horizon 2020 research and innovation program (grant agreement n° 759282). RH was additionally supported by his Cambridge European Scholarship, awarded by The Cambridge Trust (https://www.cambridgetrust.org/scholarships). JCL was supported by Grant Number R35GM139598 from NIGMS-NIH (https://www.nigms.nih.gov). ARJ, ISC and RWC would like to acknowledge the UK’s National Measurement System programme of the UK Government’s Department for Science, Innovation & Technology (https://www.gov.uk/government/publications/national-measurement-system/uk-national-measurement-system) for funding. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors have declared that no competing interests exist. Abbreviations: CRE, cis-regulatory element; FMN, flavin mononucleotide; FRAP, Fluorescence Recovery After Photobleaching; HR, hypersensitive response; IR-LEGO, infrared laser-evoked gene operator; LED, light-emitting diode; NLS, nuclear localization signal; PCB, phycocyanobilin; SEC, size-exclusion chromatography; sfGFP, superfolder green fluorescent protein; TAD, trans-activation domain; TMD, transmembrane domain; YFP, yellow fluorescent protein

Introduction Recent development of innovative and enabling high-resolution technologies has furthered the study of cellular processes, metabolic pathways, and regulatory systems. New measurements available to biologists, from single-cell gene expression levels [1,2] to quantification of metabolites in tissues and in individual living cells [3–5], shines new light on the spatial and temporal relationships between quantified analyte and biological phenomena. However, to transcend the limits of correlative studies and establish causation, we must also be able to perturb biological systems with cellular resolution. Current tools for spatiotemporal perturbation, such as chemically inducible or tissue-specific gene expression systems, can lack the desired resolution and may suffer from a series of additional limitations. For example, chemically inducible systems provide an element of temporal control, but typically depend on inducer molecules to diffuse into organs, tissues, and cells, limiting spatial and temporal resolution of application and removal. Further, they can be expensive and invasive to biological processes due to pharmacological activity and toxicity [6–9]. Correspondingly, cell-type or tissue-specific gene expression tools provide some degree of spatial control but are limited to previously characterized promoters and often lack specificity. However, optogenetic actuators, such as light inducible gene regulatory systems, could provide sought-after high-resolution spatiotemporal control because light can be delivered with exquisite precision and with low toxicity. One of the first reported synthetic light-controlled gene regulatory systems exploited a light-controlled protein–protein interaction between photoactive plant phytochromes and phytochrome interaction factors to drive reversible association of the split GAL4 transcription factor in Saccharomyces cerevisiae [10]. Following this breakthrough, the number of optogenetic actuator systems expanded rapidly from applications of light-controlled ion channels in neuroscience to numerous light-controlled biological processes in many cell types and even subcellular domains in living organisms [11]. Unfortunately, the implementation of optogenetic actuators in plants has proven challenging because plants require light-dark cycling for healthy growth and development. Most available optogenetic systems would be unable to maintain a single activation state under such conditions and thus applications are limited to those that can tolerate corresponding activation-inactivation cycles [11,12]. Furthermore, many optogenetic tools are based on light-responsive proteins from plants, such as PHYB, CRY2, PHOT&ZTL (LOV domains), and UVR8 [13], and may therefore crosstalk with endogenous light signaling pathways, potentially resulting in off-target modulation, or interference with the function of the synthetic optogenetic actuator itself. To minimize such problems, it is routine to orthogonalize system components (i.e., engineer system components to avoid interactions with endogenous components) through mutation or truncation, as exemplified by the orthogonalized PhyB-PIF6 system [8]. Hence, ideal optogenetic actuators for plants will (1) be systems that specifically respond to artificial light stimuli; (2) assume a single activation state under standard plant growth conditions, i.e., light-dark cycling; (3) function as an optically controlled switch with distinct on- and off-states; (4) be orthogonal to plant signaling processes; and (5) not require an exogenously supplied chromophore (see below). In recent years, major advances have been made towards deploying optogenetic actuators to modulate gene expression in plants. Initially, an infrared-controlled actuator (infrared laser-evoked gene operator–IR-LEGO) [14] was deployed in plants to control gene expression from heat shock promoters with high resolution. However, the use of heat shock could lead to off-target gene induction in the targeted cells. Subsequently, a red-light-controlled actuator, based on the N-terminal domains of PhyB and PIF6 from Arabidopsis thaliana, was demonstrated to achieve a high dynamic range of gene expression induction in Nicotiana tabacum- and Physcomitrium patens-derived protoplasts in response to 660 nm red light. However, 740 nm far-red-light supplementation was needed to repress system activity under white light growth—conditions that affect endogenous phytochrome activity [8]. To minimize potential effects on endogenous light signaling processes, the bacterial green- and yellow-responsive CarH photoreceptor was developed as an optogenetic gene expression switch that responds to wavelengths of light that are minimally absorbed by plants [15]. This orthogonal optogenetic system was deployed in Arabidopsis protoplasts showing high induction and low background activity, but the photoactuator system is obligatorily dependent on the vitamin B 12 derivative, 5′-deoxyadenosylcobalamin (AdoB12), an exogenously supplied photolysis-sensitive chromophore. In a recent advance to address challenges associated with activation control during light-dark cycling, the red-activated PhyB-PIF6 system was combined with an engineered blue-off module, based on the LOV-based transcription factor EL222, to generate a fully genetically encoded optogenetic gene expression system called PULSE. PULSE can be activated with red light when blue light is absent and remains off during light-dark cycling [16]. PULSE represents a major milestone for optogenetics in plants, as demonstrated by its deployment to reversibly control induction of firefly luciferase expression in stably transformed Arabidopsis. Aiming to make an optogenetic gene expression system for plants that is orthogonal, fully genetically encoded and independent of exogenously supplied chromophores, we chose to base our design on the CcaS-CcaR system, a green/red photoswitching transcription control system of cyanobacterial origin [17,18]. CcaS is a light-responsive histidine kinase that phosphorylates the response regulator CcaR, which then initiates transcription from a target promoter with cognate cis-regulatory elements (CREs) [17,18]. The CcaS-CcaR system was previously repurposed into synthetic optogenetic gene expression systems for prokaryotic hosts such as Escherichia coli [19–24], Bacillus subtilis [25], and cyanobacteria [26–28]. Target genes were placed under control of promoters with CcaR CREs and biosynthetic genes for the native chromophore of CcaS, phycocyanobilin (PCB), were exogenously expressed in hosts not naturally producing this chromophore. When repurposing this system for deployment in plants, we hypothesized that CcaS, having homology to plant phytochromes, might accept the endogenously produced phytochromobilin (PΦB) chromophore, which supports photoswitching in plant phytochromes [29]. It was expected that PΦB substitution for PCB in the green/red cyanobacteriochrome CcaS would generate a functional analog and hence circumvent the need for exogenously supplied chromophores. Moreover, the light environment used to sustain robust plant growth might be suitably adjusted to maintain the CcaS system in the same activity state in both the light and dark phases of diurnal growth. Light regimes artificially enriched in activating light could then be used to control this system with potentially minimal perturbation of endogenous signaling processes or photosynthesis itself. By repurposing a system of prokaryotic origin, we potentially also minimize crosstalk between the optogenetic actuator and endogenous plant signaling pathways. In this work, we describe the design, engineering, and validation of Highlighter, an optogenetic actuator tailored for regulating target gene expression levels in plants with cellular resolution. We engineered Highlighter for function in eukaryotic cells and to efficiently photoswitch with PΦB by mutating the chromophore-binding domain in CcaS with the aim to enable use in plants that naturally synthesize PΦB. We found that target gene expression levels can be specifically repressed with blue light and blue-enriched white light and is active with other light regimes, e.g., green-enriched white light. We also show that this blue-off behavior potentially results from blue light sensing by a CcaS flavin-binding domain distinct from its bilin-binding domain. In Nicotiana benthamiana leaves transiently expressing Highlighter, we demonstrated robust optical control over fluorescent protein expression levels, pigment production, and induction of immune responses. We furthermore demonstrate the exquisite spatiotemporal control afforded by optogenetic actuators by using Highlighter to drive contrasting expression states in neighboring cells. Because target gene expression can be modulated by altering the spectral properties of white light, Highlighter’s behavior presents a solution for achieving potentially minimally invasive regulation of target gene expression levels under standard horticultural light regimes without the need to combine systems with opposing properties. Highlighter therefore provides new opportunities for optogenetic perturbation of biological processes with high spatiotemporal resolution in plants.

Discussion The development of Highlighter, a cyanobacteriochrome-based light-inducible gene expression system for plants, represents an important step for high-resolution, potentially minimally invasive, and low-cost perturbation of plant biological processes. Advances in plant optogenetics have long been restricted by the limited availability of photoreceptors that are not native to plants and that function independently of exogenously supplied chromophores. Our conversion of the cyanobacterial CcaS-CcaR system for optogenetic control of target gene expression in plants is therefore an important innovation. The Highlighter technology exemplifies how spectrally diverse cyanobacteriochrome-based systems can be repurposed for optogenetic regulation of biological processes in plants, opening up a spectrum of new possibilities. Ideally, optogenetic actuators in plants should for most applications not photoswitch in standard horticultural light environments where cycling between white light and dark periods is required for plant growth. The complexity of light spectra and light-dark cycling inherent to most growth environments was, therefore, until recently a fundamental challenge to contend with for optogenetic systems in plants. However, the PULSE system [16] elegantly demonstrates that this complication can be circumvented by combining 2 gene-expression switches with competing properties. PULSE combines an SRDX-EL222 “blue-off” module to keep background gene expression low during the light cycle, and a PhyB-PIF “red-on” module, which is activated by monochromatic red light. The Highlighter system, however, has an inherent “blue-repressed” response, without the need for an additional co-expressed module and thus makes it a simpler system for deployment. The unexpected blue light response of the Highlighter system, however, warrants a follow-up investigation to determine its molecular basis in an inherently green/red sensor such as CcaS. Though unforeseen, inactivity in response to blue light is not unprecedented for a CcaS protein. The CcaS homolog from Nostoc punctiforme also demonstrated blue-off behavior when repurposed as an optogenetic actuator in E. coli [46] and for CcaS HL , our studies suggest that this response potentially arises from the blue-light-mediated activity of a second CcaS-associated pigment, a flavin. Although the blue light response of CcaS HL with PΦB in E. coli was recapitulated in planta, several aspects of Highlighter’s response to light stimuli in N. benthamiana leaves were unexpected. First, system activation in continuous darkness suggests that, when expressed in the absence of a light stimuli, CcaS HL might be biased towards activation. Continuous darkness is, however, a stress condition for N. benthamiana leaves and thus it is unclear if results in continuous darkness are functionally related to day-night cycling. Indeed, an 8 h dark period within a blue light time series was not sufficient to activate target gene expression. Second, YFP (nlsedAFPt9) transcript levels for Highlighter(YFP) increased and decreased over extended periods in response to the applied light treatments. The former is possibly a result of relatively low transcription activation efficiency, but could also be affected by the presence of an irreversibly blue light inactivated CcaS HL pool. The latter Highlighter inactivation rate could be slowed by a relatively stable phosphorylated CcaR HL and high transcript stability. Third, activation in red light (λ ~ 660 nm) in planta stands in contrast to results in E. coli, again possibly resulting from CcaS HL being biased towards activation in plants. Several non-mutually exclusive mechanisms could explain this unexpected behavior in N. benthamiana leaves, including differences in temperature (22°C versus 37°C) and cellular environment, an impairment or alteration of GAF domain-mediated light switching (e.g., due to differences in PΦB association efficiency or availability), spectral differences in photosynthetic tissues (e.g., chlorophyll fluorescence under green illumination), or interaction with endogenous signaling components. Unlike optogenetic systems based on plant photoreceptors, Highlighter is cyanobacterial in origin. This inherent orthogonality theoretically reduces the risk of Highlighter causing undesired off-target phenotypic effects and equally of endogenous light signaling pathways interfering with Highlighter activity. The very low background expression of Highlighter target genes in N. benthamiana leaves transiently transformed with the ΔCcaS HL and ΔCcaR HL control constructs clearly indicate that there is little endogenous activation of P HL via CcaR HL in the absence of the histidine kinase activity of CcaS HL , and similarly when CcaR HL , the response regulator, is absent. However, it remains possible that Highlighter, as a two-component system, could still interact to some degree with endogenous plant two-component system signaling components, and it might prove valuable to further orthogonalize the system. Overall, the Highlighter system provides valuable proof-of-principle for converting prokaryotic cyanobacteriochrome-based optogenetic tools for use in eukaryotic plant hosts. The combination of having a GAF domain capable of associating with PΦB and a LOV-like domain associating with a flavin makes Highlighter a potentially versatile chassis for engineering diverse light responses from a single optogenetic tool. Target gene expression control in N. benthamiana leaves is in the present system best achieved with continuous red and blue light stimuli, while also being compatible to some degree with light-dark cycling and mixed white light environments modulated with blue and red light. Further optimization of the present Highlighter system, e.g., through GAF and LOV-like domain reengineering or CcaR HL and P HL optimization, is needed to limit leaky target gene expression in blue light and maximize target gene induction in other light conditions. In the future, it will be interesting to develop and implement the suggested system improvements and deploy them in stable transgenic lines expressing Highlighter. To facilitate this process, we have successfully ported Highlighter into a Golden Gate compatible vector system and validated RUBY as a practical reporter of system activity. Given higher throughput in cloning and faster, more direct quantification of system activity levels, we consider Highlighter(RUBY) the system of choice to develop future versions of Highlighter. With advances in high-resolution quantitation, new hypotheses arise that can only be addressed by perturbing the measured biological process in precisely defined spatial regions and temporal windows. Such studies are often not feasibly conducted using chemically inducible systems because inducer molecules cannot be applied with sufficient resolution. Although future work will address these goals for Highlighter in stable transgenics, our transient expression studies, asserting optogenetic control over fluorescent reporter proteins and plant immunity, demonstrate that Highlighter is already a useful technology that allows precise optogenetic control of target gene expression down to the cellular level and can be deployed to modulate biological processes—even in complex light environments. From our experience using FRET biosensors to investigate how cellular hormone dynamics serve as signal integrators and major regulators of physiology and development [39,47–51], we also recognized a need to precisely perturb cellular hormone dynamics. The development of Highlighter was thus initiated because we envisioned deploying the technology to evaluate hypotheses stemming from high-resolution measurements, for example, distinguishing correlation from causation when investigating the connection between cellular gene expression or metabolite levels, and physiology and development. Beyond the scope of studying endogenous processes, the Highlighter technology holds great potential for plant biotechnology. Highlighter could address bottlenecks in transient N. benthamiana-based expression platforms for synthesis of high-value compounds and be used to optimally time developmental transitions or stress responses, such as immune activation to ward off pathogen outbreaks in greenhouse or vertically farmed crops. We therefore expect Highlighter to become a resource in the plant optogenetic toolbox, complementing PULSE and other exciting recent developments in the field [12,16,52–54], and changing how we approach hypothesis testing in plant biology and how we address production and yield bottlenecks in plant biotechnology.

Materials and methods A detailed description of the plasmids used in this article, and their assembly, is found in S1 Table. PCR primers were synthesized by Sigma Aldrich (S2 Table), longer DNA fragments and genes were ordered from GeneScript (S3 Table). PCRs were performed using Q5 High-Fidelity DNA Polymerase (New England Biolabs (NEB), Cat#M0491S/L) and gel extractions were done with the Macherey-Nagel NucleoSpin Gel and PCR Clean-up Mini Kit (Macherey-Nagel, Cat#740609). DNA assemblies were carried out by In-Fusion Cloning (Takara Bio, In-Fusion HD Cloning Plus kit, Cat#638909) or NEBuilder assembly (NEB, NEBuilder High-Fidelity Master Mix, Cat#M5520) as per manufacturer’s instructions. Assembly reactions were transformed into chemically competent E. coli cells: Stellar competent cells (Takara Bio, Cat#636763), chemically competent DH5α cells or NEB 10-beta competent cells (NEB, Cat#C3019). Constructs were selected on LB plates (1% Tryptone, 0.5% Yeast Extract, and 1% Sodium Chloride 1.5% Bacto agar) with appropriate selection. Plasmid purification was performed using the Qiagen QIAprep Spin Miniprep Kit (Qiagen, Cat#27106). Plasmids were verified by restriction enzyme digestion and sequencing (Sanger sequencing, Source BioScience). Site directed mutagenesis was performed using primers designed using the QuikChange Primer Design tool by Agilent Technologies with QuikChange II Kit settings (https://www.agilent.com/store/primerDesignProgram.jsp). E. coli strains were prepared for bacterial photoswitching experiments by co-transforming E. coli DH5α cells with vector sets for expressing the CcaS-CcaR system and system variants. One vector (based on pSR43.6r) expressed CcaS, or a CcaS variant, and genes for either PCB or PΦB biosynthesis, and a second vector (pBL413-003-020, derived from pSR58.6) expressed CcaR and further encoded an sfGFP reporter cassette where sfgfp is under the control of the engineered cognate promoter for CcaR, P cpcG2-172 [20]. Liquid E. coli cultures expressing CcaS-CcaR system variants were cultured in darkness for 12 to 14 h in LB (1% Tryptone, 0.5% Yeast Extract, 1% Sodium Chloride) with appropriate antibiotics in 96-well plates (VWR, Cat#732–3802), with one 3 mm glass bead and 750 μl media per well at 37°C, shaking at 220 rpm. Cultures were serial diluted in LB from 3-fold to 2,187-fold in 96-well plates (Thermo Fisher Scientific, Greiner Bio-One Cat#655101) and incubated at 37°C, shaking (250 rpm) while receiving light treatments. Light treatments were approximately 10 μmol m-2 s-1 light from LEDs with peak emissions around 400 nm, 455 nm, 525 nm, 590 nm, 605 nm, 630 nm, 660 nm, and 695 nm. Complete spectra and LED models are found in S8 Fig. Light intensities were measured using a Licor LI-250A light meter with the LI-190R Quantum Sensor and spectra were recorded using an UPRtek MK350S LED meter. sfGFP fluorescence was quantified on a fluorimeter (Molecular devices, SpectraMax i3x - fluorescence read with 5 points, 6 flashes per well, bottom read, excitation 485 nm ± 4.5 nm, and emission 516 nm ± 7.5 nm), along with the cell density (absorbance read at 600 nm, endpoint). For quantification of induction, fluorescence counts (LB fluorescence background subtracted) were plotted against cell densities (LB absorbance background subtracted). Fluorescence at OD600 nm = 0.2 was estimated from the plots with third order polynomial trendlines. For heterologous expression, purification, and spectroscopy of holo-CcaS HL , E. coli expressing hexahistidine tagged CcaS HL alongside PΦB biosynthetic enzymes HO1 and mHY2 were cultured in 24 L of LB medium at 18°C. The purification protocol consisted of 3 steps performed on an ÄKTA Pure System (Cytiva): immobilized metal-affinity chromatography (Cytiva, 5 mL HisTrap HP, Cat#17524802) for hexahistidine tagged CcaS HL , ion-exchange chromatography with a linear gradient of salt (Cytiva, 5 mL HiTrap Q HP, Cat#17115401) and size-exclusion chromatography (SEC) (Cytiva, HiLoad 26/600 Superdex 200 pg, Cat#28989336). This expression and purification protocol yielded 3 mL of the target at approximately 18 μm (determined from 280 nm absorbance of “post-purification” sample). Absorbance spectra (300 to 800 nm) for the resulting product was analyzed on a spectrometer (Agilent, Cary 60) following purification and then following illumination with light from the ColorDyne Benchtop Lightsource at the wavelengths and periods of time indicated in S2 Fig. In any given figure panel in S2 Fig, the same sample was illuminated for cumulative periods followed by data acquisition (e.g., illumination for 1 min, followed by data acquisition (spectrum “1 min”); illumination for a further minute, followed by data acquisition (“2 min”); illumination for a further 3 min, followed by data acquisition (“5 min”)). Fluorescence emission spectra were acquired between 460 and 800 nm (S3 Fig) following photoexcitation at 445 nm of the red-absorbing state of CcaS HL (to avoid further photoisomerisation of the PΦB chromophore during measurement). Agrobacterium-mediated transient transformation and photoswitching assays in N. benthamiana were performed by transforming electrocompetent A. tumefaciens GV3101, carrying the pMP90 helper plasmid [55], with Highlighter plasmids in 1 mm electroporation cuvettes (Eurogentec, Cat#CE-0001-50) using an Eppendorf Multiporator (Cat#4308, 1500 V τ 5 ms). Cells recovered for 1 to 2 h in LB at 28°C and were selected on LB plates supplemented with appropriate antibiotics. A. tumefaciens strains carrying plasmids for testing Highlighter system variants in planta were cultured at 28°C in liquid LB media, shaking at 220 rpm, supplemented with appropriate antibiotics. Cultures were pelleted, washed, and resuspended in infiltration media (10 mM MES, 10 mM MgCl 2 , 200 μm Acetosyringone (Sigma Aldrich, Cat#D134406), pH 5.6) to an OD600 nm of 0.2 to 0.4 and mixed equally with A. tumefaciens C58C1 cells carrying the p19 plasmid, encoding the p19 RNA-silencing suppressor from Tomato bushy stunt virus [56]. Four-week-old leaves were syringe infiltrated through the abaxial side and left in the dark for 8 to 16 h before undergoing light treatments. For light treatments, infiltrated leaves were cut from plants and placed on 1% water agarose plates, abaxial side up, and sealed with surgical tape. Light treatments of infiltrated leaves were performed using Heliospectra lamps (model RX30) with total light intensities of 100 μmol m-2 s-1. Monochromatic LED light regimes were generated using the 450 nm blue light channel (λ ~ 455 nm), 530 nm green light channel (λ ~ 525 nm), 620 nm orange light channel (λ ~ 630 nm), and 660 nm red light channel (λ ~ 660 nm). Modulated white light regimes, also referred to as mixed or enriched white light regimes, were defined as 50 μmol m-2 s-1 light from 5700 K white light LEDs, enriched with 50 μmol m-2 s-1 light from one of the abovementioned blue, green, and red LED channels. Light intensities were measured using a Licor LI-250A light meter with a LI-190R Quantum Sensor and spectra were recorded using an UPRtek MK350S LED meter (S10 Fig). HR responses were scored 4 to 5 days after infiltration via accumulation of HR-associated fluorescent compounds in infiltrated spots using a Syngene G-BOX (Model F3-LFP, UV Transilluminator; manual capture mode, TLUM lighting, UV032 filter). UV-fluorescence response resulting from Highlighter induced NRC4D478V expression was defined as follows: Fluorescent signals from nlsedAFPt9 and nlsTagRFP were collected by confocal imaging using a Leica TSC SP8 laser scanning confocal microscope. nlsedAFPt9 and nlsTagRFP were simultaneously excited with a 514 nm Argon laser; YFP emission was collected from 520 to 540 nm and RFP emission was collected from 595 to 625 nm on HyD detectors. Segmentation and quantification of fluorescence intensities were performed in ImageJ. 3D segmentation was performed using the 595 to 625 nm RFP channel and induction ratios were calculated as nuclear YFP signals divided by nuclear RFP signals. Overexposed voxels were excluded from the analysis when relevant. For high-resolution laser illumination to control target gene (nlsedAFPt9) expression levels, infiltrated plants were kept in darkness for 12 to 16 h post infiltration and continuously treated with blue light (100 μmol m-2 s-1 light λ ~ 455 nm) until 2.5 days post infiltration. Infiltrated leaves were then cut off plants and transferred to 1% water agarose plates and placed under the objective on the confocal microscope. Cling film was used to seal the space between the plate and objective to maintain adequate humidity for sample health. A region with cells with early detectable nuclear localized RFP fluorescence was selected for time lapse imaging of nlsedAFPt9 expression. Light treatments were performed with a 442 nm laser (40 mW, 442 nm Diode laser at 0.45%) and a 633 nm laser (10 mW 633 nm HeNe laser at 0.15%) on a Leica TSC SP8 microscope using the FRAP module. Samples were light treated for 7 h and imaged. Light treatment and imaging cycles were repeated up to 5 times. Quantification of betalain production, i.e., quantification of RUBY reporter activity via the redness of infiltrated spots, was performed 3 to 5 days post infiltration. To quantify redness, leaves were first imaged using a high-resolution flatbed photo scanner and secondly quantified using a method developed by Vivian Zhong and Ian Kinstlinger over Twitter [57]. Specifically, images were converted from RGB (Red, Green, and Blue) color space to CIELAB at the D65 white point using the Color Space Converter ImageJ plugin and the red-green component a* was measured using ImageJ. Subsequent data processing and graphical data visualization was performed using custom Python code, integrating the Pandas and Seaborn libraries [58,59]. For qRT-PCR quantification of gene expression levels, RNA was isolated from infiltrated, light-treated N. benthamiana leaf discs frozen in liquid nitrogen. Total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen, Cat#74904) and DNase treated with the Invitrogen TURBO DNA-free Kit (Thermo Fisher Scientific, Cat#AM1907). cDNA was synthesized with the SuperScript VILO cDNA Synthesis Kit (Thermo Fisher Scientific, Cat#11754–250). Gene expression levels in samples were determined in quadruplicate by qPCR using gene-specific primers (5′GAAGAGAAAGGTTGGAGGGCT3′ and 5′TGACCGAAAACTTATGCCCGT3′ for nlsedAFPt9; 5′TGTGTCAGGGAAAGAATGGAG3′ and 5′TCAGAACCGAGCATATCGAG3′ for CcaR HL ), a Lightcycler 480 (Roche Molecular Systems, Cat#05015243001) and qPCR LightCycler 480 SYBR Green I Master (Roche Molecular Systems Cat# 04887352001) according to manufacturer’s instructions. Target gene (nlsedAFPt9) expression levels were quantified using the delta-delta Ct method [60], using CcaR HL as the calibrator gene. Differential target gene expression in response to light treatments was confirmed by one-way ANOVA, equality of group variances validated by Brown–Forsythe test, and multiplicity adjusted P-values from Tukey’s multiple comparison test were depicted on graphs.

Acknowledgments The authors would like to thank Sebastian Schornack, James Locke, Tristan O. Kwan, Mike Shaw, and Sophien Kamoun for providing feedback and Sophien Kamoun for sharing NRC4D478V with us. Sebastian Schornack and Temur Yunusov assisted us to assert control over immune responses with Highlighter in N. benthamiana. James H. Rowe kindly provided technical assistance on image analysis in ImageJ for 3D segmentation of confocal Z-stacks and quantification of fluorescence ratios. We thank Vivian Zhong and Jennifer Brophy for sharing their protocol to quantify redness in N. benthamiana leaves. Also a special thanks to the late Winslow Russell Briggs for discussions and encouragement that helped us to initiate this project.

[END]
---
[1] Url: https://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.3002303

Published and (C) by PLOS One
Content appears here under this condition or license: Creative Commons - Attribution BY 4.0.

via Magical.Fish Gopher News Feeds:
gopher://magical.fish/1/feeds/news/plosone/

You are viewing proxied material from magical.fish. The copyright of proxied material belongs to its original authors. Any comments or complaints in relation to proxied material should be directed to the original authors of the content concerned. Please see the disclaimer for more details.