(C) PLOS One
This story was originally published by PLOS One and is unaltered.
. . . . . . . . . .



Multimodal CRISPR perturbations of GWAS loci associated with coronary artery disease in vascular endothelial cells [1]

['Florian Wünnemann', 'Montreal Heart Institute', 'Montréal', 'Québec', 'Thierry Fotsing Tadjo', 'Mélissa Beaudoin', 'Simon Lalonde', 'Ken Sin Lo', 'Benjamin P. Kleinstiver', 'Center For Genomic Medicine']

Date: 2023-03

Genome-wide association studies have identified >250 genetic variants associated with coronary artery disease (CAD), but the causal variants, genes and molecular mechanisms remain unknown at most loci. We performed pooled CRISPR screens to test the impact of sequences at or near CAD-associated genetic variants on vascular endothelial cell functions. Using CRISPR knockout, inhibition and activation, we targeted 1998 variants at 83 CAD loci to assess their effect on three adhesion proteins (E-selectin, ICAM1, VCAM1) and three key endothelial functions (nitric oxide and reactive oxygen species production, calcium signalling). At a false discovery rate ≤10%, we identified significant CRISPR perturbations near 42 variants located within 26 CAD loci. We used base editing to validate a putative causal variant in the promoter of the FES gene. Although a few of the loci include genes previously characterized in endothelial cells (e.g. AIDA, ARHGEF26, ADAMTS7), most are implicated in endothelial dysfunction for the first time. Detailed characterization of one of these new loci implicated the RNA helicase DHX38 in vascular endothelial cell senescence. While promising, our results also highlighted several limitations in using CRISPR perturbations to functionally dissect GWAS loci, including an unknown false negative rate and potential off-target effects.

Genome-wide association study (GWAS) is a method designed to identify genetic variants that increase the risk to develop common human diseases such as heart attacks or schizophrenia. While powerful, this method has one major limitation: it cannot unambiguously pinpoint the genes responsible for the diseases. This important step requires investigators to experimentally test genes located near the variants identified by GWAS for functions related to the diseases of interest. Here, we used a technique called CRISPR to test if genes near genetic variants implicated by GWAS in heart attacks modulate the functions of vascular endothelial cells. Endothelial cells form the inner layer of blood vessels, and play a critical role in the development of the pathology (atherosclerosis) that leads to heart attacks. In total, we found 26 regions in the human genome that include heart attacks-associated variants and that influence the functions of endothelial cells. Focusing specifically on one of our findings, we showed that the gene DHX38 regulates a process called senescence, which in turn modulates how endothelial cells respond to stimuli that promote heart attacks.

Competing interests: I have read the journal’s policy and the authors of this manuscript have the following competing interests: BPK is an inventor on patents and/or patent applications filed by Mass General Brigham that describe genome engineering technologies, is a consultant for EcoR1 capital and ElevateBio, and is an advisor to Acrigen Biosciences, Life Edit Therapeutics, and Prime Medicine. The remaining authors declare that they have no competing interests.

Funding: FW was supported by a postdoctoral fellowship from the Fonds de Recherche Santé - Québec (FRQS), and a Walter-Benjamin position from the Deutsche Forschungsgemeinschaft (DFG) and by the German Federal Ministry of Education and Research (BMBF 01ZZ2004). This work was funded (to GL) by the Canadian Institutes of Health Research (MOP #136979), the Heart and Stroke Foundation of Canada (Grant #G-18-0021604), the Canada Research Chair Program, the Foundation Joseph C. Edwards and the Montreal Heart Institute Foundation. BPK was supported by the National Institutes of Health (NIH) UM1-HG012010. The MHI High Performance Sorting Platform is supported by Canada Foundation for Innovation John R. Evans Leaders Fund (CFI#34951). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Data Availability: The data discussed in this publication have been deposited in NCBI's Gene Expression Omnibus and are accessible through GEO Series accession number GSE165925 ( https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE165925 ). All code to analyze the data and reproduce the results of this manuscript are available on Github ( https://github.com/FloWuenne/multimodal_CRISPR_CAD ) and Zenodo ( https://zenodo.org/record/7591882 ).

The development of pooled CRISPR-based screens now allows perturbation experiments to test sequences at or near most sentinel and LD proxy variants associated with CAD for a role in human vascular endothelial cells [ 17 ]. Moreover, by using inhibition (KRAB) or activation (VP64) domains tethered to an inactivated Cas9 (dCas9), it is possible to mimic loss- or gain-of-function effects that might elude perturbations due to classic Cas9 insertion-deletions (indels) [ 18 – 20 ]. Here, we carried out pooled CRISPR screens for six endothelial phenotypes relevant to atherosclerosis (presentation of adhesion proteins at the cell membrane (E-selectin, ICAM1 and VCAM1), production of NO and ROS, and intracellular Ca 2+ concentration) using three different Cas9 perturbation modalities (double-strand break induction (Cas9), inhibition (dCas9-KRAB or CRISPRi) and activation (dCas9-VP64 or CRISPRa)). Through these experiments, we aimed to identify CAD-associated variants that modulate endothelial functions. More generally, we also evaluated whether pooled CRISPR screens are a robust and comprehensive methodology to characterize GWAS loci, especially when the likely causal variants are non-coding. Our results suggest that the method is useful to prioritize variants and genes, but requires additional experimental validation to rule out false positive and negative findings.

Dysfunctional endothelial cells can also undergo senescence, which is a stress response that results in stable cell cycle arrest [ 11 ]. It can be induced by different stimuli (e.g. from ROS) and senescent cells accumulate in aging tissues to impair normal functions. Senescent cells present with cell-to-cell phenotypic heterogeneity, including transcriptomic variability, that depends on the stress inducers and cell types [ 12 , 13 ]. Senescence has been divided between primary and secondary senescence [ 14 ]. Primary senescence occurs in cells in direct response to the stress and these cells can induce secondary senescence in the surrounding cells through paracrine signalling mediated by the secretion of inflammatory cytokines, growth factors and proteases, altogether termed the senescence-associated secretory phenotype (SASP) [ 15 ]. Senescent endothelial cells are characterized by a pro-inflammatory and atheroprone phenotype that involves increased production of adhesion molecules (e.g. E-selectin, ICAM1, VCAM1) and ROS, impaired Ca 2+ signaling and reduced NO bioavailability [ 16 ]. To date, endothelial cell senescence has not been implicated as a potential pathological mechanism for CAD based on GWAS discoveries.

Half of the CAD GWAS loci do not associate with traditional risk factors. We and others have hypothesized that some of the CAD variants, which are enriched in open chromatin regions found in human vascular endothelial cells, directly modulate endothelial cell functions [ 6 , 7 ]. The functional characterization of two CAD genes in endothelial cells, PLPP3 [ 6 ] and AIDA [ 7 ], has further supported this hypothesis. Vascular endothelial cells have critical roles in atherosclerosis [ 8 , 9 ]. Upon activation, they express adhesion molecules necessary for monocyte rolling and attachment (e.g. E-selectin, ICAM1, VCAM1) and weakening of their cell-cell junctions can facilitate monocyte transmigration into the intima. Furthermore, dysfunctional endothelial cells adopt an atheroprone behaviour with changes in calcium (Ca 2+ ) signalling [ 10 ], decreased bioavailability of the vasodilator nitric oxide (NO) and increased production of reactive oxygen species (ROS).

Human genetics provides a framework to dissect the biological pathways and cellular networks implicated in atherosclerosis. Genome-wide association studies (GWAS) have already identified >250 loci associated with CAD [ 3 – 5 ]. However, the functional characterization of genes that modulate CAD risk at GWAS loci is labor-intensive. It is further complicated by the fact that most CAD variants are non-coding and are in linkage disequilibrium (LD) with a multitude of other DNA sequence variants.

Coronary artery disease (CAD) remains the main cause of mortality in the world despite widely available drugs (e.g. statins) and the known benefits of simple prevention strategies (e.g. exercise). Part of the complexity to prevent and treat CAD resides in our incomplete understanding of atherosclerosis, the pathophysiological process largely responsible for CAD initiation and progression. Atherosclerosis is triggered by many environmental risk factors and other intrinsic stimuli, and results in the dysregulation of vascular wall homeostasis due to the accumulation of cholesterol-rich lipoproteins and a maladaptive inflammatory state [ 1 , 2 ].

Finally, to determine if some of the candidate genes identified in this study could exert an effect in vascular endothelial cells in vivo, we re-analyzed single-cell RNA sequencing data from human coronary arteries [ 36 ]. We used the endothelial marker gene CDH5 to identify a cluster of endothelial cells and confirmed that these cells express DHX38, MAT2A, CCDC92, FES and FURIN, prompting future efforts to dissect the role of these genes in this cell type in atherosclerosis ( Fig 6C ).

(A) Locus view for the CAD locus with nearby gene CNNM2. We provide the position of the sentinel CAD variant (rs11191416) and the putative functional variant identified in the pooled CRISPR screen (rs78260931). The LD proxies and sgRNAs tested are also shown. ATAC-seq and RNA-seq data in resting teloHAEC are from ref. [ 7 ]. ( B ) Locus view for the CAD locus with nearby genes ZNF664 and CCDC92. We provide the position of the sentinel CAD variant (rs11057401) and the functional variant identified in the pooled CRISPR screen (rs12311848). The LD proxies and sgRNAs tested are also shown. ATAC-seq and RNA-seq data in resting teloHAEC are from ref. [ 7 ]. ( C ) Uniform manifold approximation projection (UMAP) for 11,756 cells from human right coronary arteries analyzed by single-cell RNA-sequencing [ 36 ]. We color-coded cells based on the level of expression of candidate causal CAD genes identified and characterized in this study. We used the expression of the endothelial cell marker gene CDH5 (encoding VE-Cadherin) to identify endothelial cells (circle in top left panel). All five candidate genes are expressed in human vascular endothelial cells from coronary arteries.

Targeting CRISPRa at rs12311848 did not increase the expression of ZNF664 but the expression of CCDC92, a gene located 29 kb upstream (log 2 FC = 0.74, adjusted P = 9.2x10 -5 , rank cis = 3, rank trans = 696, Fig 6B ). The sentinel CAD variant identified by GWAS at this locus is rs11057401, a missense variant in CCDC92. We targeted four sgRNAs at rs11057401 but did not detect significant effects in the Cas9 nuclease nor CRISPRi screens. This result suggests that CRISPRa gain-of-function experiments are necessary to detect the impact of this locus on endothelial dysfunction. To support this hypothesis, we ectopically over-express the main CCDC92 isoform in teloHAEC. While we measured a strong induction in CCDC92 levels, we could not detect a significant change in the expression of ICAM1, the corresponding endothelial phenotype identified in the CRISPRa screen ( S11 Fig ). Therefore, either CCDC92 is not the causal CAD gene at this locus, ectopic over-expression of the main CCDC92 isoform is not sufficient to mimic the CRISPRa effect, or the screen result is spurious.

Analysis of the RNA-seq data for the CRISPRa experiment at the CNNM2-rs78260931 locus revealed no evidence of differential expression for nearby genes (in cis, the closest differentially expressed gene was NFKB2 located 568 kb away (log 2 FC = 0.33, adjusted P = 0.008)). We also manually inspected the sequence reads that mapped to the CNNM2 region but did not find un-annotated genes that were differentially expressed ( Fig 3A ). Thus, based on our results, we cannot prioritize a candidate causal gene at this CAD locus. While this CRISPR signal could be a false positive finding due to an off-target effect, it is worth noting that the result is specific to this region and not a sgRNA-specific artifact because three of the four sgRNAs that we targeted at rs78260931 gave consistent results in the CRISPRa-ICAM1 screen ( S4 Table ).

Beside the FURIN/FES locus described above, we replicated two other CRISPRa perturbations that targeted intronic variants in CNNM2 (rs78260931) and ZNF664 (rs12311848) ( Fig 3A and 3B ). We used RNA-seq experiments to identify genes up-regulated near these variants that could mediate the CRISPRa effects on endothelial functions. While it has been reported that CRISPRa can lead to non-specific transcriptional effects such as the up-regulation of IL6 [ 35 ], we used safe harbor sgRNAs to control for such effects, IL6 was not differentially expressed in our experiments, and additional controls suggested a certain specificity of our CRISPRa results ( S10 Fig ).

In CRIMSON + cells with DHX38 sgRNA, we measured an up-regulation of CDKN1A (encoding the CDK2 inhibitor p21 WAF1/Cip1 ) and detected a higher number of cells with β-galactosidase activity when compared to CRIMSON - cells or CRIMSON + cells with a safe harbor sgRNA ( Fig 5F and 5G ). These characteristics are hallmarks of cell senescence. We validated the effect of these sgRNAs on DHX38 and CDKN1A expression levels using Cas9 ribonucleoprotein complexes in primary human coronary artery endothelial cells ( S9 Fig ). Activation of the senescence program is specific to DHX38 and not a general response to DNA damage induced by this particular sgRNA as four different sgRNAs targeting two different DHX38 exons impaired endothelial functions in the CRISPR screens.

To test this hypothesis, we replaced the antibiotic resistance marker by a fluorescence protein (CRIMSON) in the sgRNA vector in order to sort and characterize at different timepoints teloHAEC stably expressing Cas9 that have or not received a DHX38 sgRNA ( Fig 5C ). While the fraction of CRIMSON + cells is similar for safe harbor and DHX38 sgRNAs two- and four-days post-infection, it is significantly lower after seven days ( Fig 5D ). Although we did not capture many DHX38 indels in the RNA-seq experiment, we could detect a high frequency of indels (15–40%) in CRIMSON + cells already two days post-infection ( Fig 5E and S8 Table ). Importantly, we also measured a down-regulation of DHX38 expression levels in CRIMSON + cells ( Fig 5F ).

( A ) Perturbations with the Cas9 nuclease highlighted two synonymous variants (rs2074626, rs2240243) in the DHX38 gene for several endothelial phenotypes. DHX38 is located downstream of the HP and HPR genes, which have previously been associated with LDL-C levels. However, the CAD and LDL-C GWAS signals are distinct based on co-localization analyses (posterior probability for two independent association signals (H3) = 80.9%). ( B ) Gene-set enrichment analysis results for differentially expressed genes identified by RNA-seq in teloHAEC between a sgRNA targeting a DHX38 coding exon and a safe harbor negative control sgRNA. Only pathways with a Benjamini-Hochberg-corrected P-value <0.05 and normalized enrichment scores (NES) <-1 or >1 are shown. ( C ) Experimental design for the characterization of DHX38 using the fluorescent marker CRIMSON in place of an antibiotic resistance gene. We did all experiments in teloHAEC that stably express Cas9. We monitored the impact of a DHX38 sgRNA on cell proliferation, indel induction, gene expression and senescence-associated β-galactosidase (SA-βGal) activity. ( D ) Comparison of endothelial cell proliferation between teloHAEC with a DHX38 sgRNA or a safe harbor negative control sgRNA. The differences in the number of CRIMSON + cells were not significant two or four days post-infection. However, there were 27% less CRIMSON + cells with DHX38 sgRNA relative to the safe harbor control at seven days post-infection (Student’s t-test P-value = 7.3x10 -8 ). Results are mean ± standard deviation for 6 replicates for safe harbor and three replicates for two DHX38 targeting sgRNA. ( E ) Quantification of DHX38 indels by tracking of indel by decomposition (TIDE) analysis. As expected, we found no indels in the CRIMSON - cells ( S8 Table ). However, in CRIMSON + cells that received a DHX38 sgRNA, we found indels with an average frequency of 15%, 42% and 40% at day 2, 4 and 7, respectively. Results are mean ± standard deviation for 6 replicates for safe harbor and three replicates for two DHX38 targeting sgRNA. ( F ) Expression levels of DHX38 and CDKN1A in CRIMSON - and CRIMSON + teloHAEC that have received a sgRNA that targets DHX38 or a safe harbor region (negative control). There were no significant differences in DHX38 expression levels at day 2. However, at day 4 and 7, DHX38 was significantly down-regulated and CDKN1A was significantly up-regulated in CRIMSON + cells that received the DHX38 sgRNA. N.S., not significant. We provide Student’s t-test P-values when P<0.05. Bars are mean normalized expression and error bars represent one standard deviation. ( G ) Quantification of senescent teloHAEC by flow cytometry using senescence-associated β-galactosidase (SA-βGal) staining. At day 4 and 7 post-infection, there were significantly more senescent cells in the CRIMSON + DHX38 sgRNA experiment than in the CRIMSON - cells or in the CRIMSON + cells that received the safe harbor sgRNA. We used the DNA damaging agent etoposide as a positive control to induce senescence. N.S., not significant. We provide Student’s t-test P-values when P<0.05. Results are mean percentage SA-βGal + teloHAEC and error bars represent one standard deviation.

Two of the validated sgRNAs target exonic variants (rs2074626, rs2240243) in DHX38 ( Fig 5A ). This GWAS CAD signal is located near an association signal for LDL-cholesterol (LDL-C), but a co-localization analysis suggests that the two signals are likely distinct ( Fig 5A , coloc posterior probabilities H3:80.9% and H4:19.1%). Nonetheless, we cannot rule out the possibility that the DHX38 variants may also contribute partially to CAD through an effect on LDL-C. DHX38 encodes an RNA helicase involved in splicing, and mediate Cas9 nuclease effects on E-selectin ( Fig 3A and 3B ) and VCAM1 (as validated by subsequent analyses, S6 Table ). We confirmed the DHX38-related E-selectin result using Cas9 ribonucleoprotein complexes ( S8 Fig ). In RNA-seq experiments with a sgRNA targeting DHX38 (seven days post-infection, TNFα treatment), DHX38 was not down-regulated and we found few reads mapping to DHX38 with Cas9-mediated indels (<2%). However, we noted a strong gene expression signature suggesting an effect on cell proliferation with the modulation of genes involved in the p53, G2/M checkpoint and E2F target genes pathways ( Fig 5B and S7 Table ). To reconcile these observations, we hypothesized that endothelial cells with DHX38 detrimental indels undergo senescence-mediated cell cycle arrest, have a growth disadvantage and induce a response in surrounding cells without DHX38 indels through the SASP in a TNFα-stimulated environment.

( A ) CRISPRa perturbations highlighted rs12906125 as a potential regulatory variant for FURIN and FES. The variant overlaps an ATAC-seq peak in the promoter of FES and a H3K27ac-defined enhancer that physically interacts with the FURIN promoter through chromosomal loops predicted by the ABC model applied to teloHAEC Hi-C data [ 7 , 33 ]. ( B ) Within a 2.5-Mb window, FES and FURIN are the top two differentially expressed genes when targeting rs12906125 by CRISPRa in teloHAEC. The inset plot shows the induction of both FES and FURIN expression with sgRNA_06939 when compared to the control safe harbor sgRNA. ( C ) teloHAEC are heterozygous (A/G) at rs12906125. We used base editing to change the genotype at rs12906125 to G/G. There was no significant difference in expression for FES and FURIN when comparing unstimulated teloHAEC with the A/G and G/G genotypes. However, upon activation with TNFα, we found that the reduction in FURIN levels was independent from the rs12906125 genotype whereas for FES, the reduction was genotype-dependent. Numbers above the bars are Student’s t-test P-values. We tested at least six clones of each genotype.

In the CRISPRa experiment using RNA-seq, we found a significant up-regulation of both FES (log 2 (fold-change (FC)) = 3.75, adjusted P = 8.5x10 -173 , rank cis = 1, rank trans = 4) and FURIN (log 2 FC = 0.78, adjusted P = 1.5x10 -10 , rank cis = 2, rank trans = 197) ( Fig 4B ). FURIN, which encodes a proprotein convertase, represents a strong candidate CAD causal gene at this locus: its specific knockdown in human endothelial cells reduces atheroprone characteristics such as monocyte-endothelial adhesion and transmigration [ 34 ]. In contrast, FES, which encodes a tyrosine protein kinase that can control cell growth, differentiation and adhesion, has not been implicated in vascular endothelial cell biology. To determine which of the two is the more likely causal CAD gene, we changed the genotype at rs12906125 in teloHAEC using adenosine base editing. teloHAEC are heterozygous at rs12906125 (A/G) and we could generate clones with the G/G genotype (because of the sequence context, we could not get A/A teloHAEC cells with cytosine base editors directing C>T edits on the other strand). In unstimulated cells, genotype at rs12906125 had no impact on the expression of FURIN and FES ( Fig 4C ). However, because rs12906125 maps in the middle of an ATAC-seq peak and a binding motif for NFκB/p65 [ 32 ], we reasoned that the genotypic effect could be revealed by an inflammatory stimulus. Indeed, TNFα treatment reduced the expression of FURIN in teloHAEC with the A/G and G/G genotypes, whereas its effect on FES expression was genotype-dependent ( Fig 4C ). When we compared E-selectin expression at the mRNA and protein levels between A/G and G/G clones, the difference was not significant, potentially because we could not generate A/A clones and the effect of the A/G-to-G/G base edit on FES expression was modest in comparison to the CRISPRa impact ( S7 Fig ). While we cannot exclude FURIN as an excellent candidate causal CAD gene, our base editing experiment suggests that there might be >1 causal genes at this locus and that FES should be tested in future experiments aimed at determining its precise biological function(s) in atherosclerosis.

A CRISPRa/E-selectin perturbation that we replicated implicated rs12906125, a variant at the FURIN/FES locus previously prioritized as potentially causal for CAD by transcriptomic and epigenomic profiling in human endothelial cells [ 32 ]. The corresponding Cas9 knockout and CRISPRi results for E-selectin were non-significant, suggesting that gene activation is required to reveal an endothelial phenotype as this locus ( S4 Table ). rs12906125 is in strong LD with the CAD sentinel variant rs2521501 (r 2 = 0.91), is located in the FES promoter and overlaps an ATAC-seq peak as well as a H3K27ac-defined enhancer that physically interacts with the FURIN promoter ( Fig 4A ) [ 7 ]. The same SNP is an eQTL for FES in human primary aortic endothelial cells [ 32 ] and arterial tissues from GTEx.

To validate our results, we selected eight CRISPR perturbations at seven CAD loci and performed individual sgRNA infection and FACS experiments ( S6 Table ). For this validation step, we prioritized variants that were significant for >1 cellular phenotypes and that had strong effect sizes in the CRISPR screens. For each experiment, we compared the distribution of the FACS-based cellular phenotype between control sgRNAs and the best sgRNA targeting each selected CAD variant ( Fig 3B ). Across three independent biological replicates, we could validate six of the eight selected CRISPR perturbations (one-tailed t-test P<0.05, S6 Table ). One of the replicated sgRNA implicated an outstanding candidate CAD gene: for MAT2A, targeting Cas9 to the synonymous rs1078004 variant increased ROS production in TNFα-treated teloHAEC ( Fig 3B ). MAT2A encodes a methionine adenosyltransferase that is responsible for the biosynthesis of S-adenosylmethionine, a precursor of the potent antioxidant glutathione [ 31 ].

Several of the CAD loci identified by GWAS have been implicated in blood lipid metabolism (e.g. LDLR, APOE, PCSK9). Because genetic variation within these loci are likely to influence risk through an effect on lipid levels, we did not anticipate to identify them in our endothelial cell functions CRISPR screens. Of the variants that mapped to 10 lipid loci included in our screens, all were negative across the different endothelial phenotypes tested except rs118039278 located in an intron of LPA (CRISPRa for ICAM1, FDR<0.001, Fig 3A ). Although LPA is not expressed in teloHAEC, CRISPRa could induce its ectopic expression and the encoded Lp(a) lipoprotein has been shown to induce endothelial dysfunction [ 30 ].

( A ) Heatmap of CAD-associated variants that are significant (false discovery rate (FDR) ≤10%) for at least one of six endothelial phenotypes tested in the teloHAEC pooled CRISPR screens. Each row corresponds to a combination of Cas9 variant and cellular readout, and each column corresponds to a CAD variant. For each variant, we added the name of a nearby gene to simplify locus identification, although we do not imply that these genes are causal. Dendrograms of rows and columns represent hierarchical clustering based on euclidean distance. The FDR is capped at 0.1%. ( B ) Validation by flow cytometry of six hits from the pooled CRISPR screens. For each validation, we used the top sgRNA from the pooled CRISPR screens to target the variant/locus with the corresponding Cas9 variant. We compared the distribution of the fluorescence intensity of the cellular markers (x-axis) between the sgRNA identified in the screens and a safe harbor negative control sgRNA. We assessed statistical significance using the Kolmogorov-Smirnov (KS) test, all validations shown are significant (KS P-value <2.2x10 -16 ). Validations were performed in at least three independent experiments for each sgRNA ( S6 Table ). For E-selectin and ICAM1, the fluorochrome is PE; for ROS, the fluorochrome is FITC.

Our pooled CRISPR screens compared sgRNA frequencies between the bottom and top 10% fractions for each cellular readout. Using MAGeCK’s maximum likelihood estimation method that combines results for sgRNA that target the same variant ( Methods ), we identified 51 significant variant-endothelial phenotype results (false discovery rate (FDR) ≤10%) involving 42 different variants located within 26 CAD loci ( Fig 3A and S4 Table ). The majority of these 42 variants is located in non-coding regions: 30 variants are in introns, 5 variants are in intergenic regions, four variants are in exons and three variants are in promoters ( S4 Table ). The 42 variants were also not enriched in ATACseq peaks identified in teloHAEC (9.5% (4/42) vs. 7.7% for all targeted variants in the screens; binomial P = 0.56). We found significant results for almost all combinations of Cas9 modality and FACS phenotypes, and most of these results were specific to a single combination ( Fig 3A ). For 15 CAD loci where we could target all LD proxies with sgRNAs ( Fig 1D and S3 Table ), we detected no significant signals in our CRISPR assays, suggesting that genes within these genomic regions modulate CAD risk through different functions or cell types, or that our functional assays were not sensitive enough to capture their effects. When compared with genomic loci with no significant results, CAD loci with at least one significant variant in our CRISPR screens were not better captured by designed sgRNAs (median coverage 73% vs. 78% of LD proxies, Wilcoxon’s test P = 0.70) but had significantly more LD proxies (median 41 vs. 9 variants, Wilcoxon’s test P = 1.1x10 -4 ).

As an additional quality-control step in our experiment, we designed sgRNAs against the coding and promoter sequences of SELE, ICAM1 and VCAM1, which encode the three adhesion proteins measured in our FACS assays ( Fig 1F ). We observed significant depletion of sgRNAs targeting coding exons and promoter regions of these genes in the top vs. bottom 10% FACS fractions with Cas9 or CRISPRi ( Figs 2C and 2D and S6 ). In the CRISPRa experiments, the same sgRNAs were enriched in FACS fractions with high E-selectin, ICAM1 or VCAM1 levels ( Figs 2E and S6 ). The three other endothelial phenotypes measured in our experiments—NO and ROS production, and Ca 2+ signalling—are physiological readouts that are not the product of a single gene. In the absence of confirmed positive control genes that we could target to validate our system, we carefully calibrated the flow cytometry assays for these readouts using appropriate agonists/inducers. Our screens are sufficiently sensitive to detect sgRNAs targeting CAD loci that have strong effects on these hallmarks of endothelial dysfunction. It is also important to mention that CRISPR perturbation screens will miss variants or genes that cause small phenotypic effects, for instance because of gene redundancy or cellular compensation, or because of an impact on cell proliferation.

To assess Cas9 efficiency in our experiments, we included in the library 330 sgRNAs against the coding sequence of genes essential for cell viability. For Cas9 and CRISPRi, we found a strong depletion of sgRNAs targeting essential genes among the sequenced FACS cell fractions (Kolmogorov-Smirnov (KS) test P<2.2x10 -16 and P = 1.6x10 -13 , respectively) ( Fig 2B ). We also noted a minor but significant shift toward depletion in the sgRNA count distribution of essential genes for the CRISPRa experiments (KS test P = 3.7x10 -6 ), potentially due to steric hindrance effects by the dead Cas9 moiety near the transcriptional start site of these genes or the toxic impact of gene over-expression ( Fig 2B ).

( A ) Two-dimensional uniform manifold approximation and projection (UMAP) representation of 148 fluorescence-activated cell sorting (FACS) samples based on the normalized read counts of the top 10% most variable sgRNAs across all samples. ( B ) Density distributions of effect sizes (Beta, x-axis) across all Cas9 variants for essential genes and the rest of the sgRNA library. Positive betas indicate that sgRNA are enriched in the cell fractions when compared to the input library, while negative betas indicate a depletion of sgRNA across all samples. We observed a depletion of sgRNA targeting essential genes with all three Cas9 variants. ( C-E ) Rank of all control sgRNAs and targeted CAD variants in the ( C ) Cas9, ( D ) CRISPRi and ( E ) CRISPRa screens for three adhesion proteins: E-selectin (left), VCAM1 (middle) and ICAM1 (right). For each panel, the y-axis corresponds to the effect sizes (Beta, comparing top vs bottom FACS 10% fractions). For the Cas9 and CRISPRi experiments, we found an enrichment of sgRNAs targeting the coding and promoter sequences of genes encoding adhesion proteins in the bottom 10% cell fractions (negative Betas). In contrast, sgRNAs targeting the promoter of these genes were enriched in the top 10% cell fractions in the CRISPRa experiments. In green and blue, we highlight sgRNAs targeting coding exons and promoters, respectively. The number in front of the name of each control sgRNA indicates its rank in the corresponding analysis.

We utilized lentiviruses to deliver our pooled CRISPR libraries to teloHAEC that stably express one of three Cas9 variants (Cas9, CRISPRi, CRISPRa) ( Fig 1F ). We treated Cas9 and CRISPRi (but not CRISPRa) infected cells with TNFα in order to find genes that can block (Cas9, CRISPRi) or induce (CRISPRa) a pro-inflammatory response. We labelled cells with fluorescent antibodies against E-selectin, VCAM1, or ICAM1, or with fluorescent dyes for signalling molecules (ROS, NO, Ca 2+ ), and sorted cell populations by flow cytometry (FACS) to collect the bottom and top 10% cells based on fluorescence intensity ( Figs 1F and S2 – S4 ). We amplified and sequenced the sgRNAs from the FACS cell fractions to identify sgRNAs that have a significant effect on endothelial functions. For each screen, we performed and combined results from at least four independent biological replicates (sgRNA-level correlation analyses between replicates are in S5 Table ). Quality-control analyses of sorted cell fractions showed a good representation of sgRNA diversity (mean Gini index = 0.076±0.01) and a good read coverage per sgRNA (mean number of aligned reads per sgRNA = 1995±2981) ( S5 Fig ). Analysis of the 10% most variable sgRNAs across all assays revealed clustering of samples along the Cas9 modalities ( Fig 2A ).

( A ) From 92 loci associated with coronary artery disease (CAD) risk by genome-wide association studies (GWAS), we identified 2893 sentinel and linkage disequilibrium proxy variants for testing. For each of these variants, we attempted to design a maximum of five high-quality guide RNAs (sgRNAs) within a 100-bp window. In the design of the library, we also included sgRNAs that target genes essential for cell viability, as well as sgRNAs that target the coding sequence and promoter of genes that control endothelial cell functions (known genes, positive controls). ( B ) Number of sgRNAs per targeted variant that passed stringent quality-control filters. In total, we designed 7393 sgRNAs against 1998 CAD-associated variants (mean and median number of sgRNA per variant are 3.7 and 5, respectively). ( C ) Distribution of the absolute distance of the sgRNA cut-site relative to the targeted variant in base pairs (the vertical dashed line indicates mean sgRNA distance). ( D ) Fraction of variants at each locus that are successfully targeted by our pooled CRISPR screens. Each row represents one of the CAD loci that we tested. In green is the fraction of variants—including sentinel and LD proxies—for which we designed high-quality sgRNAs and obtained results for the endothelial function phenotypes. On average, 76% of variants at any given CAD locus are captured in the screens (vertical dashed line). ( E ) Most severe annotation for the 1998 CAD variants targeted by the lentiviral sgRNA libraries using ENSEMBL’s Variant Effect Predictor (VEP) module. ( F ) As a control step, we sequenced the plasmid library to ensure even representation of sgRNAs in the pool. Then, we produced four independent batches of lentiviruses which we used to infect teloHAEC cells that stably express Cas9, dCas9-KRAB (CRISPRi) or dCas9-VP64 (CRISPRa). Following antibiotic selection and TNFα treatment (for Cas9 and CRISPRi), we stained teloHAEC for cell surface markers (E-selectin, ICAM-1, VCAM-1) or intracellular signaling molecules (reactive oxygen species (ROS), nitric oxide (NO), calcium (Ca 2+ )). By flow cytometry, we sorted cells from the bottom and top 10 percentiles of the marker distributions, and sequenced sgRNAs found in each fraction.

The design of our sgRNA library is summarized in Fig 1A . To target genomic regions associated with CAD, we collected 92 GWAS sentinel variants at 89 CAD-associated loci [ 21 – 24 ] and retrieved their proxy variants in strong LD (r 2 >0.8 in populations of European ancestry). Using this strategy, we derived a set of 2,893 variants (92 GWAS sentinel and 2,801 LD proxy variants) ( Fig 1A and S1 Table ). For each of these variants, we designed a maximum of five high-quality sgRNAs ( Fig 1B ). The mean distance between sgRNA potential cut-sites and the targeted variants was 22-bp based on available PAM sites ( Fig 1C ). Using FORECAST [ 25 ], we estimated that 10±16% of the CRISPR/Cas9-mediated deletion alleles would disrupt the targeted variants ( S1 Fig ). After quality-control steps, we generated a list of 7,393 sgRNA that targeted sequences at or near 1,998 variants at 83 CAD loci ( S2 Table ). On average at each CAD locus, our sgRNA library covered 76±22% of the targeted variants ( Fig 1D and S3 Table ). Of the 83 tested loci, we could capture 100% of the targeted variants at 20 CAD loci and ≥80% of variants at 38 loci ( S3 Table ). The majority of the targeted variants are in intronic (70.8%) or intergenic (10.2%) sequences, 7.7% of the variants overlap with ATAC-seq peaks identified in immortalized human aortic endothelial cells (teloHAEC), and 4.1% are located in predicted enhancers identified in human primary endothelial cells and connected to target genes by the EpiMap Project ( Fig 1E and S4 Table ) [ 7 , 26 ]. Even if most targeted variants are non-coding, we decided to include Cas9 as a perturbation modality in our screens because we reasoned that indels within or near regulatory sequences (e.g. transcription factor motif) could impact cellular phenotypes [ 27 – 29 ].

Endothelial cell senescence is both a physiological and pathological process [ 45 ]. In health, it signals the system for vascular endothelium repair. Senescence also increases with age and in response to traditional CAD risk factors. When it overcomes the regeneration capacity of the system or upon stress, senescence causes endothelial dysfunction and can lead to vascular diseases. Senescent cells accumulate at the sites of atherosclerosis in human blood vessels [ 46 , 47 ] and their selective elimination using transgenic strategies or drugs (senolytics) delays atherogenesis progression in mice [ 48 ]. Our data suggest that CAD-associated DHX38 variants–and potentially variants at other loci awaiting functional characterization–affect key endothelial functions, potentially by inducing premature senescence. This observation links a large body of literature that has implicated senescence in atherosclerosis with variants and genes that modulates endothelial functions. As clinical trials to test the efficacy of senolytics on vascular diseases are now in discussion [ 49 ], it will be important to explore whether specific CAD variants or polygenic scores are predictive of their clinical response.

We acknowledge several additional limitations of our approach: (1) the six selected cellular readouts may not completely capture how genetic variation associated with CAD influences endothelial functions, (2) Cas9 nuclease can introduce large untargeted truncations, which may disrupt >1 genes [ 42 ], (3) Cas9-mediated indels could miss the targeted variants, (4) CRISPRi can silence transcriptional activity over a long distance that can cover many genes, thus complicating the interpretation of the findings [ 43 ], and (5) CRISPRa is considered to be mostly effective when targeted to sequences that are proximal to the targeted genes [ 44 ]. In particular for CRISPRa, we presented two examples of validated perturbations targeting non-coding variants (ZNF664/CCDC92 and CNNM2, Figs 3B , 6A and 6B ) for which we could not assign causal genes based on transcriptomic analyses. These results cast doubts in using CRISPRa to characterize distal regulatory sequences, especially if it is not supported by orthogonal results. Along the same line, we noted weak correlations of our screen results between CRISPR modalities ( Fig 3A ). While it is possible that certain genomic regions are more amenable to a specific type of perturbation (e.g. coding sequences with Cas9 nuclease), it also possible that some of the CRISPR results seen with a single modality are false positive hits due to the method rather than the screened cellular phenotypes. This needs to be considered carefully when selecting hits for further downstream functional characterization.

Some of the genes prioritized in our CRISPR perturbation screens (e.g. FES, DHX38) likely play essential cellular functions in endothelial cells. This could raise concerns about the specificity of some of our results and their relevance for CAD in vivo. But there is an alternative scenario in which the disruption of essential genes within GWAS CAD loci, either by genetic variants or CRISPR perturbations, impairs cellular phenotypes (as measured by FACS) and leads to endothelial dysfunction, a known pathological mechanism for CAD. A recent large-scale trans-ancestry meta-analysis provides additional support to this model. Beside confirming that CAD GWAS loci are enriched for regulatory sequences identified in endothelial cells, the study also found an enrichment of genes with essential functions, such as genes involved in cell cycle progression, division and replication (including CDKN1A, the senescence marker used in Fig 5F )[ 5 ]. Therefore, maybe some of the variants and genes found in our CRISPR screens modestly modulate cellular functions, leading to endothelial dysfunction, atherosclerosis and CAD. Ultimately, the phenotypic characterization of hypomorphic alleles of these essential genes in mouse models (using endothelium-specific targeting techniques) may be needed to address this important question.

The main finding of our CRISPR experiments is the identification of DHX38 as a strong candidate causal gene for CAD. Through Cas9-mediated deletions, we found that loss of DHX38 functions in endothelial cells impairs cell cycle progression, induces the expression of the cell cycle inhibitor CDKN1A, and increases β-galactosidase activity, all hallmarks of cellular senescence. DHX38, also known as PRP16, encodes an RNA helicase implicated in splicing with previously described functions in tumorigenesis [ 39 ] and retina degeneration [ 40 ]. Interestingly, deregulation of RNA splicing through aging has been proposed as one mechanism leading to aging-related chronic diseases through an effect on cellular senescence [ 41 ]. While our results suggest that DHX38 influences CAD risk by modulating endothelial dysfunction and senescence, it is possible that part of the CAD association signal at the locus is also due to nearby variants in weak linkage disequilibrium that associate with LDL-C ( Fig 5A ).

We designed our sgRNA library using a variant-focused approach. However, it is likely that some of the findings from our CRISPR screens result from loss- or gain-of-function effects on endothelial genes independently of the causal variants. For instance, we identified and validated sgRNAs near synonymous variants in DHX38 and MAT2A using the Cas9 nuclease. While synonymous variants can have phenotypic consequences, it is more likely that these variants are in LD with the causal variants but were captured in our screens because they targeted loss-of-function indels to the DHX38 and MAT2A coding sequences. Similarly, ectopic activation or inhibition of gene expression by CRISPRa and CRISPRi can highlight candidate endothelial genes even if the sgRNAs do not directly overlap causal variants.

There were also variants and genes that we expected to find but did not recover. For instance, we did not identify rs17114036, a likely functional variant that controls the expression of PLPP3 in endothelial cells, although this negative result may arise because the underlying enhancer requires hemodynamic stress to be active [ 6 ]. Furthermore, our screens did not yield variants at CAD loci that include PECAM1 (adhesion protein CD31) and NOS3 (endothelial NO synthase), two genes with important roles in endothelial cells. As for PLPP3, it might be that we did not activate endothelial cells with the right stimulus to detect the functional impact of these variants/genes in our assays. It is also possible that some loci will require the precise engineering of alleles (e.g. using base or prime editing) to detect a cellular phenotype, or that the phenotypic effect of a variant at the cellular level is too low to distinguish a true signal from the experimental noise inherent to any large-scale omics approach. One lesson learned from our experiments is that the false negative rate of such pooled CRISPR screens is likely not negligeable, implying that variants or genes should not be ruled out simply based on a non-significant CRISPR perturbation result.

As for most complex human diseases, many GWAS loci associated with CAD do not include obvious candidate causal genes nor implicate known pathophysiological mechanisms. To elucidate their mechanisms and gain insights into atherosclerosis, we carried out multiple CRISPR screens to test if CAD variants impact vascular endothelial functions. By combining six different endothelial cell readouts and three Cas9 modalities, we identified sequences at or near 42 variants at 26 CAD loci ( Fig 3A ). This list is depleted of variants that modulate CAD risk through an effect on lipid metabolism and enriched for loci of unknown functions ( S3 Table ). We found sequences near ARHGEF26, ADAMTS7, and GUCY1A3, genes previously implicated in leukocyte transendothelial migration [ 23 ], endothelial cell angiogenesis [ 37 ], and NO signaling [ 38 ], respectively. We also retrieved rs17163363, an intronic variant in MIA3 that controls the expression of AIDA in endothelial cells [ 7 ]. To document the false positive rate of our results, we tested eight sgRNAs prioritized in our screens and could validate six of them using the same FACS-based endothelial function readouts.

Materials and methods

Design of the sgRNA library We retrieved 92 sentinel genetic variants associated with coronary artery disease (CAD) at genome-wide significant levels (P-value ≤5x10-8) from four GWAS meta-analyses available at the time of the design of this experiment [21–24]. For the design of the sgRNA library, we included all sentinel variants as well as variants in strong LD (r2 >0.8 in the 1000 Genomes Project European-ancestry populations). Because the four large CAD GWAS available when we designed our sgRNA library included mostly individuals from European-ancestry populations, we limited our search for LD proxies to this group. For each variant—sentinel and LD proxy—we identified all possible sgRNA in a 100-bp window centered on the variant itself. Our primary objective in designing this library was to identify high-quality sgRNAs that map as close as possible to the targeted SNPs, independently of genomic annotations. We prioritized sgRNA with the highest predicted quality using the CRISPR OffTarget Tool (version 2.0.3) [50] with a Targeting_guide_score ≥ 20 and the “matches with 0 mismatches” = 1 and “matches with 1 mismatch” = 0 settings. We discarded sgRNA that overlapped heterozygous variants, indels and/or multi-allelic variants in the teloHAEC genome (build hg19). In total, we excluded 895 variants from our screen due to difficulties in designing f high quality sgRNAs in their vicinity (86.5% did not pass our sgRNA score threshold, 2.4% overlapped with a heterozygous variant in teloHAEC, and 11.2% both did not pass the quality threshold and overlapped a variant). We selected sgRNA targeting essential genes from a previously published study [51]. For potential positive control genes (SELE, SELP, ICAM1, VCAM1, PECAM1, NOS3, VWF, SOD2, SOD3, GPX3, CAT, ITPR1, ITPR2, ITPR3, ATP2A2, ATP2A3, PLN, CAV1, and TRPV4), we selected sgRNA from the Human GeCKOv2 CRISPR knockout pooled library [52]. We also selected sgRNA that targeted the promoter (300-bp window before the transcriptional start site) of positive control genes for the CRISPRa (dCas9-VP64) experiments. For all selected loci (variants, coding sequences, gene promoters), we retained the five top scoring sgRNA for the library design. Finally, we added two sgRNA for the SELE locus (SELE_g1, SELE_g2) that we frequently use to validate TNFɑ stimulation. This resulted in a final library of 8051 sgRNA (S2 Table). The sgRNA were synthesized in duplicates by Agilent Technologies (Cat-#: G7555B) to accommodate the specific requirements of the Cas9/dCas9-KRAB and dCas9-VP64 (specific MS2 tracrRNA) experiments. We amplified each specific pool of oligonucleotides as previously described [19], with the following small modifications: we performed two PCR using NebNext High fidelity Master mix (Cat-#: M0541L). The first PCR was used to amplify each pool separately using 2.5ng of pooled oligonucleotides and 500nM of each primer (for the Cas9/dCas9-KRAB library, we used U6_subpool_fwd and Guide_CM_barcode1_rev; for the dCas9-VP64 library, we used U6_subpool_fwd and Guide_MS2_Barcode2_rev). Cycling conditions for PCR1 were 98°C for 30 sec, then 15 cycles of 98°C for 10 sec; 55°C for 10 sec; 72°C for 15 sec and a final step of 72°C for 2 min and a 10°C hold. We performed the second PCR to add homologous sequences, using the U6_screen_fwd and Tracr_rev oligonucleotides for the Cas9/dCas9-KRAB library, and the U6_screen_fwd and Tracr_MS2_rev oligonucleotides for the dCas9-VP64 library, in both cases using ⅕ of PCR1 as template. Cycling conditions for PCR2 were 98°C for 30 sec, then 10 cycles of 98°C for 10 sec; 55°C for 10 sec; 72°C for 15 sec and a final cycle of 72°C for 2 min and 10°C hold. See table S9 Table for primer details. After gel extraction and PCR purification, we performed Gibson assembly in both respective vectors (pHKO9-Neo and lentisgRNA(MS2)-zeo backbone addgene 61427). For pHKO9-Neo, we replaced the Crimson fluorescent gene in the pHKO9-Crimson-CM vector (gift from Dan Bauer’s lab) by a neomycin resistance (NeoR) sequence. Briefly, we amplified the NeoR gene from our pCas9-Neo vector [53] using BsiWI-Neo-Fwd and MluI-Neo_rev primer (S9 Table). After digestion by BsiWI and MluI, we cloned the segment in pHKO9-Crimson_CM, which had been digested with BsiWI and MluI. We amplified each library using ten independent maxi-preparations (Macherey-Nagel cat# 740424). To control the quality of both libraries, we sequenced them on an Illumina HiSeq4000 instrument and calculated the Gini index, which summarizes read distribution across sgRNA in a given pool. For a good-quality sgRNA library, the expected Gini index is ≤0.2, and we obtained Gini indexes of 0.050 and 0.052 for the Cas9/dCas9-KRAB and dCas9-VP64 library, respectively.

Engineering of teloHAEC cell lines to stably express Cas9 variants or base editors TeloHAEC are immortalized human aortic endothelial cells obtained by over-expressing telomerase (ATCC CRL-4052). These cells have a normal female karyotype (46;XX) and exhibit many of the properties and functions of human vascular endothelial cells [7]. We previously showed that the teloHAEC transcriptional and epigenomic responses to TNFα treatment is highly correlated with the responses of primary human coronary artery endothelial cells to the same stimulation [7]. We cultivated teloHAEC in Vascular Cell Basal Medium supplemented with Vascular Endothelial Cell Growth kit-VEGF (ATCC through Cedarlane PSC-100-030 and PSC-100-041). We generated our teloHAEC cells models expressing either Cas9, dCas9-KRAB or dCas9-VP64 + MPHv2 using Addgene vectors #52962, #46911, #61425 and #89308, and base editors using plenti-U6-gRNAentry-EFS-ABE8e-(D10A)SpRY-P2A-Blast, called telo-HAEC ABE8e-SpRY. We carried out lentiviral infection as previously described [53].

Pooled CRISPR screen experiments We produced four batches of lentiviruses for each sgRNA library pool (Cas9/dCas9-KRAB, dCas9-VP64). We infected each teloHAEC cell line (Cas9, dCas9-KRAB, dCas9-VP64) at a multiplicity of infection of 0.3 using each batch of viruses separately. Following viral infection, we selected cells using zeocin (teloHAEC-dCas9-VP64) or G418 (teloHAEC-Cas9/-dCas9-KRAB) for five (teloHAEC-dCas9-VP64) or seven days (teloHAEC-Cas9/-dCas9-KRAB) in vascular cell basal medium (ATCC PCS-100-030) to remove any cells that did not incorporate a vector. After selection, we stimulated cells expressing Cas9 or dCas9-KRAB using TNFɑ (10ng/μl) for four hours to induce a pro-inflammatory response; we did not stimulate cells expressing dCas9-VP64, reasoning that the VP64 transcriptional domain should activate gene expression. Following TNFɑ stimulation, we immunostained cells (around 50M cells) with antibodies linked to phycoerythrin for adhesion molecules (E-selectin (BD BIOSCIENCES Cat-#: 551145), VCAM-1 (Cat-#: 12-1069-42), ICAM-1 (Cat-#: 12-0549-42)) or we incubated with fluorescent dye-based reagents for endothelial signaling markers: (nitric oxide (NO) (DAF-FM Diacetate, Cat-#: D23844)), reactive oxygen species (ROS) (CM-H2DCFDA, Cat-#: C6827), calcium signaling (Fura Red, Cat-#: F3021)). We calibrated the FACS assays with positive control treatments to make sure that we could robustly detect changes in the measured phenotypes. Antibodies and fluorescent dye-based reagents were titrated to use optimal concentrations. We also quantified how teloHAEC were responding to ionomycin for calcium signaling, to sodium nitroprusside for NO and to TNFα for reactive oxygen species. For adhesion molecules, we utilized sgRNA targeting coding exons and promoter regions of SELE, ICAM1 and VCAM1 as positive controls. Unless otherwise stated, we purchased all antibodies and dyes from ThermoFisher Scientific. Subsequently, we sorted stained cells by flow cytometry on a BD FACSARIA FUSION flow cytometer to collect the top and bottom 10% of fluorescently labeled cells. For each experiment, we infected 20-50M cells at a multiplicity of infection (MOI) of 0.3 (740–1860 cells/sgRNA) and analyzed a similar number of cells (20-50M) for FACS, resulting in approximately 500 to 1200 cells/sgRNA. FACS traces were generated with FlowJo (BD Biosciences). We extracted genomic DNA from both top and bottom 10% cell fractions separately (around 5M cells in each fraction) using the QIAGEN DNeasy Blood and Tissue kit (Cat No. 69504) according to manufacturer’s instructions.

Amplification and sequencing of pooled CRISPR experiments We amplified sgRNA sequences from genomic DNA via PCR, followed by a cleanup step using the QIAGEN QIAquick PCR purification kit (Cat-#: 28104) according to the manufacturer’s instructions. We used the primer sequences and PCR settings as previously described in ref. [19]. We created sequencing libraries using Illumina TruSeq adapters according to the manufacturer’s protocols. We sequenced the libraries on an Illumina Hiseq4000 instrument at the McGill University and Genome Quebec Innovation Centre (MUGQIC). Generally 6 samples were multiplexed per sequencing lane for a target read coverage of ~500 reads per sgRNA per sample (S5B Fig).

Computational analysis of pooled CRISPR screen data We processed raw sequencing data from the BCL to the FASTQ format using bcl2fastq at MUGQIC. Raw FASTQ reads were quality-controlled using FastQC (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) and MultiQC [54]. We performed downstream analysis of sgRNA sequencing data using MAGECK (v.0.5.9) [55]. We quantified sgRNA sequences using MAGECK count against the list of sgRNA sequences in the library (S2 Table), allowing for no mismatches in the sgRNA sequence. We then tested the difference in sgRNA counts between the bottom and top 10% flow cytometry fractions for each readout using MAGECK maximum likelihood estimation (mle) method with median normalization [56]. Predicted functional impact of variants and overlap with genomic features was computed using VEP [57], biomart and Goldmine in R [58–60].

UMAP representation of sample-level count data We normalized raw sgRNA counts using variance stabilizing transformation (vst) in DESeq2 [61]. To account for baseline differences between plasmid preparations, we further normalized samples to their respective vector library by dividing the vst normalized sgRNA count by the vst normalized count of the Cas9/dCas9-KRAB or dCas9-VP64 library, respectively. We calculated principal components using the top 10% most variable sgRNA (805 sgRNA) across all cell sorted samples based on normalized counts. Next, we used the loadings from the first three principal components in Uniform Manifold Approximation and Projection (UMAP) [62] to create a two-dimensional embedding of the normalized sgRNA count data. Each dot in the UMAP plot represents one sequenced sample (top or bottom 10% of stained cells).

Analysis of sgRNAs targeting essential genes To test for potential effects of sgRNA on endothelial cell death and proliferation, we compared sgRNA counts of all samples across the same cellular model (Cas9, dCas9-KRAB, dCas9-VP64) against the respective baseline vector library sgRNA count using MAGECK mle. We used sgRNAs targeting essential genes in the teloHAEC Cas9 cellular model as positive controls.

Single sgRNA validation We individually cloned each sgRNA for validation as previously described [63]. We produced lentiviruses, infected cells, performed antibiotic selection, and stained cells as for the pooled CRISPR screen. We analyzed cells using flow cytometry (BD FACSCelesta (BD Biosciences, San Jose, CA, USA) equipped with a 20 mW blue laser (488 nm), a 40 mW red laser (640 nm), and a 50 mW violet laser (405 nm). For each experiment, we measured the mean fluorescent intensity (MFI) obtained for sgRNA of interest and compared it with the MFI for control sgRNA (safe-harbor and/or scrambled sgRNA). Safe-harbor sgRNA sequences were based on Pellenz et al. [64]. We performed each experiment at least three times. For statistical analyses, we used Student’s t-test and determined that a sgRNA had a significant effect on the measured phenotype when a one-tailed P-value ≤0.05. For DHX38 Crimson experiments, we individually cloned each sgRNA (2 different guides were used for DHX38 (sg10966 and sg11664) and 2 for Safe-Harbor, respectively) in pHKO9-Crimson-CM vector (gift from Dan Bauer’s lab). We produced lentiviruses, infected cells and performed flow cytometry on a BD FACSARIA FUSION flow cytometer at day 2, day 4 and day 7 post-infection. We analyzed the percentage of Crimson positive cells and we sorted Crimson positive and negative cells to extract RNA in each fraction. We extracted total RNA using RNeasy Plus Mini Kit (Qiagen cat #: 74136). We measured RNA integrity and concentration using Agilent RNA 6000 Nano II assays (Agilent Technologies) on an Agilent 2100 Bioanalyzer and Take3 on Cytation V (Biotek). We reverse transcribed 750ng of total RNA using random primers and 1 U of the MultiScribe Reverse Transcriptase (Applied Biosystems) in a 20 μL reaction volume at 100 mM dNTPS and 20 U of RNase inhibitor with these three steps: 10 min at 25°C, 120 min at 37°C and 5 min at 85°C. We followed the MIQE guidelines to assess quality and reproducibility of our qPCR results [65]. We performed qPCR in triplicates for all samples using: 1.25 μL of cDNA (1/50 dilution), 5 μL of Platinum SYBR Green qPCR SuperMix-UDG (Life Technologies) and 3.75 μL of primer pair mix at 0.8 μM on a CFX384 from Biorad. We used the following thermal profile: 10 min at 95°C, and 40 cycles of 30 s at 95°C, 30 s at 55°C and 45 s at 72°C. We carried out melting curve analyses after the amplification process to ensure the specificity of the amplified products. We also simultaneously performed qPCR reactions with no template controls for each gene to test the absence of non-specific products. Cq values were determined with the CFX Manager 3.1 (Bio-Rad) software and expression levels were normalized on the expression levels of the house-keeping genes TATA-box binding protein (TBP), hypoxanthine-guanine phosphoribosyltransferase (HPRT), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) using the ΔΔCt method. The primer sequences are in S9 Table.

Single-guide RNP validation in human primary endothelial cells We nucleofected Human Coronary Artery Endothelial Cells (HCAEC) (Lonza through Cedarlane CC-2585) using Nucleofector 4D and P5 Primary cell 4D Nucleofector X kit S (Lonza, V4XP-5032) according to the supplier’s recommendations. First, we warmed-up 2 ml of media without antibiotics (same as for teloHAEC) per condition in a 6-wells plate format. We annealed crRNA and TracrRNA (from IDT, Alt-R CRISPR-Cas9 crRNA XT and Alt-R CRISPR-Cas9 tracrRNA) in nuclease duplex buffer at 30uM, 5 min at 95°C then cool down to room temperature to obtain gRNA. We incubated 6ul of the gRNA (2 different guides were used for DHX38 (sg10966 and sg11664) and 2 for Safe-Harbor, respectively) with 1ul of Cas9 (IDT, Alt-R S.p. Cas9 Nuclease V3) diluted ⅓ and 18ul of P5 solution for 10 minutes at RT. We added 300K cells resuspended in 5ul of supplemented P5 buffer and mixed with the 25ul of RNP complex. We used protocol EH-100 for nucleofection. Afterward, we added 70ul of media without antibiotics per condition and transferred 100ul of each condition per well. We changed the media 24 hrs later and passed them on day 4 to extract gDNA/RNA and cultivated them for another 3 days. We also extracted gDNA/RNA on day 7. gDNA and RNA/cDNA and qPCR are performed as described above.

PCR for determination of CRISPR-Cas9-induced indels or base editing efficiency We isolated gDNA using QuickExtract DNA Extraction Solution (Epicentre, QE0905) from 1x105 cells. We used 100 or 200 ng of gDNA as a template for PCR reaction with the corresponding primers (see S9 Table). gDNA from parental teloHAEC cells was used as control. Obtained PCR products were analysed by electrophoresis on a 1% agarose gel prior to Sanger sequencing. We used TIDE (tracking of indels deconvolution) software for analysis [66].

Base editing of rs12906125 We infected our teloHAEC ABE8e-SpRY population with a guide in rs12906125 locus, CGGGACGGTCGGGCCGGTCC, cloned in pHKO9-Neo-CM as previously described [63]. teloHAEC are endogenously heterozygous at rs12906125 (A/G) and the treatment with ABE8e-SpRY should edit the genotype to G/G. Because of multiple Cs near the SNP, it was not possible to engineer clear edits towards the A/A genotype using cytosine base editors. After 3 weeks of proliferation, we derived clones by limiting dilution and extracted gDNA for PCR. We performed PCR as already described in the previous section with primers sequences (see S9 Table) and we used EditR software for analysis [67]. 45 clones out of 60 were analyzed by EditR and 15 out of 45 were edited (perfect edit, with the A/G genotype at rs12906125 edited to the G/G genotype, ~30% editing efficiency). We extracted also RNA to perform FES and FURIN mRNA expression by qPCR. RNA extraction, cDNA and qPCR we generated as described in the previous section. We compared expression with and without TNFα (10ng/μl) treatment for four hours.

Assays cell senescence Using the same experimental design (DHX38-Crimson), we performed beta-galactosidase staining using the CellEvent Senescence Green Flow Cytometry Assay Kit from Invitrogen on day 2, day 4 and day 7 following the manufacturer’s protocol. Briefly, we trypsinized and we fixed the cells with 2% paraformaldehyde solution for 10 minutes at room temperature, washed them in 1%BSA/PBS and incubated for 1h30 in 1/500 working solution. After incubation, we washed the cells with 1%BSA/PBS and analyzed them by flow cytometry. We measured the β-galactosidase fluorescence signal in positive and negative Crimson cells independently. As positive control, non-infected cells were treated with 20 μM of Etoposide (Sigma, E1383-25) for 2, 4 and 7 days.

Transcriptome data analysis For RNA-seq analysis, we extracted RNA using RNeasy plus mini kit from Qiagen (cat #: 74136). RNA-seq experiments were carried out by the Centre d’Expertise et de Services Genome Quebec using rRNA-depleted TruSeq stranded (HMR) libraries (Illumina) on an Illumina Hiseq 4000 instrument (paired-ends, 100-bp reads) and by The Center for applied Genomics (Toronto) using rRNA-deletion library prep on an Illumina NovaSeq-SP flow cell. We quality-controlled raw fastq files with FastQC and multiQC [67]. We used kallisto (v. 0.46.0) to quantify transcript abundances [68] against ENSEMBL reference transcripts (release 94) followed by tximport to calculate gene-level counts [69]. We utilized regularized log-transformation (rlog) in DESeq2 [61] as input for principal component analysis (PCA). DESeq2 [69] was further used to identify differentially-expressed genes between teloHAEC cell models (Cas9, dCas9-VP64) infected by lentiviruses with safe-harbor sgRNA or sgRNA identified in the pooled CRISPR screens. We excluded genes expressed with less than 10 reads across all samples from the analysis. We performed shrinkage for effect size estimates using apeglm using the lfcShrink method [70]. Genes differentially expressed with a Benjamini-Hochberg adjusted p-value ≤ 0.05 were considered significant (S10 Table). Gene set enrichment analysis was performed using the R package fgsea using 100,000 permutations against the Hallmark gene sets from msigdbr (https://igordot.github.io/msigdbr/) [71,72]. We quantified short indels in the RNA-seq data of DHX38 (sgRNA_10966) and MAT2A (sgRNA_02249) using the tools transIndel and Genesis-Indel, which are specifically designed to identify indels in the unmapped read fraction of samples [73,74].

Overexpression of open reading frames (ORF) in teloHAEC We obtained pEntry vectors containing the CCDC92 ORF from John D. Rioux’s lab. First, we cloned the gateway cassette from pLVX-EF1α-attR1-ccdB-attR2-IRES-puro-emGFP digested with XbaI (NEB, cat no R0145S) and ligated with Quick ligase from NEB (cat no M2200) in pLVX-EF1α-IRES-mCherry (refer as Empty-mCherry thereafter) also digested by XbaI and dephosphorylated using Fast AP (ThermoFisher cat no FEREF0654). Briefly, we used 50ng of digested vector and a ratio of 3:1 of insert. We performed ligation for 15 min at room temperature and then we transformed 2μL of ligation in One shot ccdB Survival 2 T1 Competent cells (Life Technologies, cat no A10460) and plated on LB agar ampicillin plates. Both vectors were gifts from John D. Rioux’s lab. We individually cloned each ORF using Gateway LR Clonase II Enzyme mix protocol (Life Technologies, cat no 11791020) in the new pLVX-EF1α-attR1-ccdB-attR2-IRES-mCherry vector. Briefly, we used 300ng of each pEntry/pDONR ORF vector with 300 ng of pLVX-EF1α-attR1-ccdB-attR2-IRES-mCherry with 4μL of 5X LR buffer and TE pH8.0 to 16 μL, then we added 4 μL of LR enzyme and incubated for 1 hr at 25°C. After this incubation, we added 2 μL of proteinase K and incubated for another 10 min at 37°C. We transformed 1 μL of each reaction in One Shot Stbl3 Chemically Competent E. coli (Life Technologies, cat no C7373-03) and plated on LB agar ampicillin plates. All vectors and ORF sequences have been validated by Sanger sequencing.

Analysis of scRNA-seq data from human coronary arteries Single-cell gene expression matrix from human right atherosclerotic coronary arteries (three male and one female donors), was downloaded from NCBI GEO (GSE131780, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE131780). The data was re-analyzed using the Seurat package in R with a standard single-cell clustering pipeline. Gene expression data was normalized using the SCTransform function from Seurat (v.3.2.3), regressing out the percentage of mitochondrial gene expression. Principal components analysis was performed, followed by dimensional reduction with Uniform Manifold Approximation and Projection (UMAP) using the first 20 principal components as input. Gene expression was visualized on the first two UMAP dimensions using the kernel density function (plot_density) from the Nebulosa package (v.0.99.92)[75] for endothelial cell marker and candidate genes.

[END]
---
[1] Url: https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1010680

Published and (C) by PLOS One
Content appears here under this condition or license: Creative Commons - Attribution BY 4.0.

via Magical.Fish Gopher News Feeds:
gopher://magical.fish/1/feeds/news/plosone/