(C) PLOS One
This story was originally published by PLOS One and is unaltered.
. . . . . . . . . .



Expanding the tolerance of segmented Influenza A Virus genome using a balance compensation strategy [1]

['Xiujuan Zhao', 'Innovation Research Institute Of Traditional Chinese Medicine', 'Shandong University Of Traditional Chinese Medicine', 'Jinan', 'Xiaojing Lin', 'College Of Pharmacy', 'Ping Li', 'Zinuo Chen', 'Chengcheng Zhang', 'Balaji Manicassamy']

Date: 2022-10

Abstract Reporter viruses provide powerful tools for both basic and applied virology studies, however, the creation and exploitation of reporter influenza A viruses (IAVs) have been hindered by the limited tolerance of the segmented genome to exogenous modifications. Interestingly, our previous study has demonstrated the underlying mechanism that foreign insertions reduce the replication/transcription capacity of the modified segment, impairing the delicate balance among the multiple segments during IAV infection. In the present study, we developed a “balance compensation” strategy by incorporating additional compensatory mutations during initial construction of recombinant IAVs to expand the tolerance of IAV genome. As a proof of concept, promoter-enhancing mutations were introduced within the modified segment to rectify the segments imbalance of a reporter influenza PR8-NS-Gluc virus, while directed optimization of the recombinant IAV was successfully achieved. Further, we generated recombinant IAVs expressing a much larger firefly luciferase (Fluc) by coupling with a much stronger compensatory enhancement, and established robust Fluc-based live-imaging mouse models of IAV infection. Our strategy feasibly expands the tolerance for foreign gene insertions in the segmented IAV genome, which opens up better opportunities to develop more versatile reporter IAVs as well as live attenuated influenza virus-based vaccines for other important human pathogens.

Author summary Foreign nucleotide insertions often interfere with the replication/transcription of the modified segment of IAV genome, impairing the delicate balance of the segmented genome during IAV infection. In general the larger the insertion is, the more the balance is impaired. The limited tolerance of IAV genome greatly restricts the creation and application of recombinant IAVs. In this study, we developed a “balance compensation” strategy to expand the tolerance of IAV genome. In coupled with appropriate compensatory enhancement during initial construction, recombinant IAVs harboring much larger foreign insertions are successfully generated and maintain genetically stable, facilitating their use as powerful tools, e.g., the reporter IAVs and live-attenuated influenza virus-vectored vaccines.

Citation: Zhao X, Lin X, Li P, Chen Z, Zhang C, Manicassamy B, et al. (2022) Expanding the tolerance of segmented Influenza A Virus genome using a balance compensation strategy. PLoS Pathog 18(8): e1010756. https://doi.org/10.1371/journal.ppat.1010756 Editor: Daniel R. Perez, University of Georgia, UNITED STATES Received: March 17, 2022; Accepted: July 21, 2022; Published: August 4, 2022 Copyright: © 2022 Zhao et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability: All relevant data are within the paper and its Supporting information files. Funding: This work was supported by National Natural Science Foundation of China (82104134 to R.D.) and Key Technology Research and Development Program of Shandong, China (2020CXGC010505 to Q.C.). The funding body has no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors have declared that no competing interests exist.

Introduction Influenza A virus (IAV) is a respiratory pathogen that causes seasonal epidemics and occasional pandemics globally [1]. Although there are several FDA-approved drugs available to treat IAV infections, including the viral ion channel M2 blockers (amantadine and rimantadine), the neuraminidase inhibitors (oseltamivir, zanamivir and peramivir) and a cap-dependent endonuclease inhibitor baloxavir marboxil [2,3], the emergence of drug resistance mutations illustrates the pressing need for novel anti-influenza therapeutics [4]. Recently, the rapid development of reverse genetics facilitates generation of replication-competent recombinant IAVs carrying varied reporter genes, allowing for rapid quantification of viral replication, and noninvasive imaging of infected tissues in living animals [5–9]. These live imaging animal models of IAV infection will have far-reaching benefits for novel antiviral developments. However, since the tolerance of IAV genome to foreign insertions is limited due to its segmented architecture, most of these reporter IAVs up to date are either attenuated or unstable during replication in cell culture or animals [5–9]. Moreover, the reporter genes are usually restricted to those with relatively small ones in size. To further optimize the reporter IAVs, a directed evolution strategy has been developed. For example, Katsura et al. and Cai et al. independently passaged reporter IAVs serially in mice, generating mouse-adapted variants with restored virulence and enhanced reporter gene expression [10,11]. Sequencing analysis revealed that mutations in the RNA-dependent RNA polymerase (RdRp) constituents contribute to the wildtype-like fitness in both cases, although the precise mutation sites differ [10,11]. Nonetheless, this directed evolution strategy is time-consuming and the desired outcome may not always be guaranteed. Thus it is desirable to develop a general method that allows free manipulation of IAV genome. The genome of IAV consists of eight negative-stranded viral RNA (vRNA) segments, of which each segment encodes one or two major open reading frames (ORFs), including PB2 (Polymerase basic 2), PB1 (Polymerase basic 1), PA (Polymerase acid), HA (Hemagglutinin), NP (Nucleoprotein), NA (Neuraminidase), M (Matrix proteins) and NS (Non-structural proteins). The central coding region of individual vRNAs is flanked by conserved 3’ and 5’ non-coding terminal sequences [12]. The first 13 nucleotides (nts) at the 5’ end and the first 12 nts at the 3’ end of vRNAs that are partially complementary interact to form promoter structures for viral RdRp complex [13,14]. Both the conformations of influenza polymerase complex and promoter structure are flexible and interactively regulate the dynamical initiation of transcription and replication [14,15]. In addition, the multiple segments compete with each other to recognize viral polymerase for replication and transcription [16]. For instance, if the amount of RdRp complexes is limited, the replication/transcription of one segment vRNA would be negatively affected by the presence of the other seven counterparts, but this competition could be relieved as polymerase subunits accumulates [16]. This is consistent with the finding that the replication and transcription of the different segments follow different kinetics during IAV infection, reflecting a delicate dynamical balance of the segmented genome [17]. The balance of the multiple segments during IAV infection is vulnerable to artificial modifications. For example, it was reported that specific mutations in the promoters can enhance the levels of vRNA and mRNA [18,19], however, upon incorporation of these promoter-upregulating mutations, the recombinant IAV attenuates in replication, highlighting the critical need for the delicate balance between replication, transcription and protein expression of IAV segments [19]. In addition, many other factors including the segment-specific non-coding regions (NCRs), the length of coding regions, as well as the inherent activity and template preference of viral RdRp are involved in the competition [16,17,20]. In our previous report, we demonstrated that foreign insertions can drastically reduce the replication/transcription capacity of the modified segment due to inevitable increase in segment length, adversely impacting the balance of the multiple segments in the levels of vRNA and mRNA during IAV infection [21]. For example, when the imbalance occurred to the NS segment: First, inadequate vRNAs of modified NS are available for incorporation into progeny virions, producing a large amount of NS-null noninfectious particles [21]; Second, the expression of NS1 proteins decreased accordingly and may no longer counteract the host immune responses efficiently [22]; Third, the accumulation of NEPs which play a pivotal role to mediate nuclear export of viral ribonucleoproteins was greatly affected [23,24]. Together these mechanisms lead to a reduced replication and attenuation of the reporter IAVs. In this study, we propose that incorporation of compensatory enhancing mutations during initial construction of a reporter IAV can rebalance the multiple segments, and subsequently reduce or eliminate the mechanism of attenuation. As a proof of concept, a reporter influenza PR8-NS-Gluc virus which carries a Gaussia luciferase (Gluc) gene fusing to NS1 was used as a starting point [25], and the aforementioned enhancing mutations were introduced into the promoter elements of the modified NS-Gluc segment to rectify the imbalance. We show that an optimized reporter IAV that shows improved replication kinetics and virulence was generated. Moreover, the tolerance of IAV genome can be further expanded using this “balance compensation” strategy. In conjugation with stronger compensatory enhancements, a recombinant IAV carrying a much larger firefly luciferase (Fluc) gene was subsequently generated.

Discussion The limited tolerance of IAV genome to foreign gene insertion has hampered the development of recombinant IAVs as tools, e.g, reporter viruses [5,6,30], and live-attenuated influenza virus-vectored vaccines bearing foreign antigens [31–33]. Previously, we have unraveled an underlying mechanism that foreign insertions may cause reduced transcription/replication capacity of the modified vRNA segment in competition with other wildtype segments, impairing the balance of the segmented genome during infection. Thus, the balanced profiles of the eight segments at the levels of vRNA, mRNA and protein expression are all adversely affected, leading to defective genome packaging into progeny virions [21]. As a consequence, the replication and virulence of recombinant IAVs are attenuated, and the foreign insertions may be lost rapidly during virus passaging. In the present study, we developed a “balance compensation” strategy to expand the tolerance of the segmented IAV genome to facilitate genome manipulations. As depicted in Fig 7, directed optimization of recombinant IAVs is achieved by incorporating compensatory enhancements (CEs) to rectify the reduced replication of modified segment and genome imbalance. PPT PowerPoint slide

PNG larger image

TIFF original image Download: Fig 7. Representative diagram of the molecular mechanism underlying attenuation of reporter IAVs and the proposed “balance compensation” strategy for directed optimization. (A) The NS segment was modified with foreign insertions, resulting in reduced replication/transcription of the NS-derived vRNA and impaired balance of the multiple segments. Subsequently, a large proportion of progeny virions are NS-null and non-infectious. (B) For directed optimization of the reporter IAV, proper compensatory enhancement was incorporated during initial construction. The replication/transcription of NS-derived vRNA was specifically increased, while rebalance of the segmented genome could be achieved, restoring the wildtype-like fitness. Of note, the multiple segments in wildtype PR8 virus infected cells were shown in equal molar ratio for conceptual illustration only. https://doi.org/10.1371/journal.ppat.1010756.g007 In this study, a well-studied set of replication-enhancing mutations CE1 at the promoter element was introduced into the modified NS-Gluc segment of the reporter influenza PR8-NS-Gluc virus, and it was shown that CE1 could correct the reduced replication/transcription of modified NS-Gluc segment. Further, CE1 incorporation not only restored the wildtype-like fitness of the reporter virus (see Fig 2), but also significantly enhanced the reporter Gluc expression (see Fig 3). Importantly, we successfully generated stable replication-competent recombinant IAVs integrating a much larger Fluc gene coupled with a much stronger set of replication-enhancing mutations CE2 (see Figs 4 and 6). Our work demonstrates there is delicate balance of the segmented IAV genome for genome manipulations. For instance, since CE1 can compensate the reduced replication/transcription efficacy of NS-Gluc to the level of natural NS, and CE2 leads to overcompensation (see Fig 2B), it seems reasonable to assume that CE1 but not CE2 was more suitable for directed optimization of the recombinant PR8-NS-Gluc virus. However, since Fluc is much larger and its insertion to the genome could impair the balance of segmented genome more drastically, the CE2 but not CE1 was more optimal for generating a more stable recombinant PR8-NS-Fluc virus (see Fig 4). It is noteworthy that CE2 is likely not optimal enough to compensate the reduced replication of NS-Fluc segment, and additional compensation(s) is likely required to generate more stable IAVs (see Fig 4B). In addition, since PR8 strain was laboratory-adapted and likely harbors increased tolerance for genome rearrangement, generation of recombinant IAVs from clinical isolates may require more optimization for genome balance. Our “balance compensation” strategy, described here, is also segment dependent. Besides NS, other segments including PB1, PB2, PA, NA and NP have also been engineered to create reporter IAVs [5–7,30,34]. Considering the promoter sequences is highly conserved among all segments, the aforementioned promoter enhancing mutations should also apply to optimize these reporter viruses. In addition, many segment-specific enhancement candidates should be considered. First, as a U/C polymorphism at position 4 exists within the 3’-NCR of IAV segments, U4 contributes to a higher transcription/replication capacity compared to C4 [35]. For those segments that carry original C4 at the 3’-NCR, a C4 to U4 mutation should be employed as compensatory enhancement. Second, the segment-specific NCR sequences are also involved in vRNA transcription/replication [36–38]. For example, it was reported that a U13 to C13 mutation in the 3′ end of the NA gene promoted the expression of viral RNA and protein, while mutation of other sites within the UTR could differentially regulate viral genomic transcription and translation [36]. We speculate that a U13 to C13 mutation at the variable NCR sequence of the modified NA would compensate to the attenuation [7]. Third, since the accumulation of vRNA and mRNA during IAV infection is dynamic and segment-specific, both the inherent activity and template preference of viral RdRp may be involved in the regulation [17,20]. As mentioned above, Katsura et al. generated a mouse-adapted reporter influenza Venus-PR8 virus carrying a Venus gene within NS segment, and identified a PB2-E712D substitution that could stabilize the foreign gene insertion and restore wildtype-like replicative ability and virulence in mice [10,22]. Mechanistic studies revealed that the polymerase fidelity was not affected by PB2-E712D substitution [22], and the inherent polymerase activity of PB2-E712D is even lower than that of wildtype PB2 [10]. Notably, considering the inherent polymerase activity was determined using an NP-derived template [10], and it was demonstrated that PB2-E712D enhanced the transcription/replication efficiency of the modified NS as compared to NP [22], we speculate that the mutated polymerase may possess an increased preference to NS segment over NP. Further studies are needed to investigate the preference profile of the mutated polymerase to the eight segments. It is possible that these enhancement candidates can be used independently or in combination to achieve appropriate compensation, i.e., to rebalance the segmented genome. In summary, we have developed a “balance compensation” strategy for generation of reporter IAVs. Our strategy allows us to further expand the tolerance of IAV genome to foreign insertions. The success of the present study not only provides diverse valuable reporter IAVs and robust live-imaging mouse models of IAV infection, but also encourages generation of novel reporter viruses with more versatile capabilities, e.g., the bi- or tri- reporter viruses that express two or three foreign reporters from different segments [39]. Moreover, the feasibility of our strategy opens up better opportunities to develop live attenuated influenza virus-vectored vaccines for other highly pathogenic viruses and bacteria.

Materials and methods Ethics statement All animal experiments within this study were approved by the Institutional Animal Care and Use Committee (IACUC) of Shandong University of Traditional Chinese Medicine (Approval: SDUTCM20211230001). Cell culture Human embryonic kidney cell line 293T and Madin-Darby canine kidney (MDCK) epithelial cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; Cellgro, Manassas, VA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Carlsbad, CA, USA), 1000 units/mL penicillin and 100 μg/mL streptomycin (Invitrogen, Carlsbad, CA, USA). Infections were performed in Opti-MEM containing 2 μg/mL N-tosyl-L-phenylalanine chloromethyl ketone (TPCK)–trypsin (Sigma-Aldrich, St. Louis, MO, USA). All cells were grown at 37 °C in 5% CO2. Plasmids (i) Construction of the IAV minigene expressing plasmids. The plasmids expressing NS-derived reporter vRNAs were constructed by replacing the NS1-NEP ORFs with Fluc or Rluc encoding ORFs, under the control of the human RNA polymerase I (Pol-I) promoter. The NCR NS -Fluc fragment was amplified with primers NCR NS -Fluc-Forward/NCR NS -Fluc-Reverse using the pISRE-Luc plasmid as template, while the NCR NS -Rluc fragment was amplified with primers NCR NS -Rluc-Forward/NCR NS -Rluc-Reverse from pRL-TK plasmid. Both NCR NS -Fluc and NCR NS -Rluc fragment were then cloned into the Sap I linearized pPol-I vector using In-fusion cloning kit (Takara, Beijing, China) following the manufacturer’s protocol, generating pNCR NS -Fluc and pNCR NS -Rluc respectively. Next, NCR NS -Fluc fragments carrying panhandle-stabilizing mutations were amplified using indicated primer NCR NS -x-Forward paired with NCR NS -Fluc-Reverse from pNCR NS -Fluc template, and then cloned into pPol-I as described above, generating pNCR NS -x-Fluc mutants. (ii) Construction of plasmids expressing mutated NS-Gluc vRNAs. In order to introduce desired mutations into the modified NS-Gluc segment, NCRns-3,8m-Forward and NCRns-3,5,8m-Forward were respectively paired with the primer 5’-NCR-Reverse to amplify NSCE1-Gluc and NSCE2-Gluc fragments from the original pDZ-NS-Gluc plasmid [25]. The two fragments were then cloned into pPol-I vector as described above, generating pPolI-NSCE1-Gluc and pPolI-NSCE2-Gluc respectively. As controls, the natural NS, original NS-Gluc and natural M were amplified using primers 3’-NCR-Forward/5’-NCR-Reverse and cloned into pPol-I vector, generating pPolI-NS, pPolI-NS-Gluc, and pPolI-M, respectively. (iii) Construction of plasmids expressing wildtype and mutated NS-Fluc vRNAs. The modified NS-Fluc was constructed using similar strategy for construction of NS-Gluc, except that an additional 2A protease sequence was inserted between NS1 and Fluc to avoid fusion. The NS-Fluc construct was divided to 3 fragments for initial amplification. The left 3’-NCR-NS1 and right NEP-5’-NCR fragment were amplified using pDZ-NS-Gluc as template with primers 3’-NCR-Forward/NS1-2A-Reverse and 2A-NEP-Forward/5’-NCR-Reverse, respectively. The middle 2A-Fluc fragment was amplified using primers 2A-Fluc-Forward/Fluc-2A-Reverse from the template pNCRns-Fluc. Adjacent fragments overlap for at least 15 nts. All the three fragments and the Sap I linearized pPol-I vector were then ligated using the In-fusion cloning kit, generating wildtype pPolI-NS-Fluc plasmid. To introduce desired mutations into the modified NS-Fluc segment, NCRns-3,8m-Forward and NCRns-3,5,8m-Forward were respectively paired with the primer 5’-NCR-Reverse to amplify NSCE1-Fluc and NSCE2-Fluc mutant fragments from pPolI-NS-Fluc. The two fragments were then cloned into pPol-I vector as described above, generating pPolI-NSCE1-Fluc and pPolI-NSCE2-Fluc respectively. All the primer sequences used above were shown in supplementary S1 Table. Reverse genetics The influenza A/Puerto Rico/8/1934 virus (H1N1, PR8) and recombinant reporter viruses were generated and propagated as described previously [25]. In brief, the IAV rescue plasmids of PR8 backbone including pDZ-PA, -PB1, -PB2, -NP, -HA, -NA, -M, and -NS1, were co-transfected into 293T cells using Lipofectamine 2000 (Invitrogen, USA) according to manufacturer’s instructions. At 24 hour post transfection (h.p.t.), fresh MDCK cells were seeded and co-cultured with 293T cells. After 48 h incubation, the influenza PR8 virus was harvested from the supernatant. After plaque purification, the virus was amplified in 10-day-old chicken embryos. The viral titer was determined by inoculation of serial 10-fold dilutions of stock virus onto MDCK cells and calculated by the Reed-Muench method [25]. For modified viruses, the rescue plasmid pDZ-NS1 were replaced with indicated pDZ-NS-Gluc, pPolI-NSCE1-Gluc, pPolI-NSCE2-Gluc, pPolI-NS-Fluc, pPolI-NSCE1-Fluc and pPolI-NSCE2-Fluc for construction of recombinant viruses PR8-NS-Gluc, PR8-NSCE1-Gluc, PR8-NSCE2-Gluc, PR8-NS-Fluc, PR8-NSCE1-Fluc and PR8-NSCE2-Fluc, respectively. X31-NSCE2-Fluc was generated using rescue plasmids for the six internal segments of PR8-NSCE2-Fluc, as well as pDZ-X31-HA and pDZ-X31-NA that encode HA and NA of X31 respectively. The dual-template RdRp assays The dual-template reporter RdRp assay was conducted as previously described with slight modifications [16]. Briefly, the minigene expressing plasmids pNCR NS -Fluc (or its mutants pNCRx-Fluc) and pNCR NS -Rluc were co-transfected into 293T cells with IAV RdRp constituent expressing plasmids pFlu-NP, pFlu-PB1, pFlu-PB2, and pFlu-PA using Lipofectamine 2000 (Invitrogen, USA) according to manufacturer’s instructions. At 24 h.p.t., the cells were harvested, and a proportion of the cells were removed for luciferase assays using Dual-Glo Luciferase Assay System (Promega, Madison, WI USA), while the left cells were extracted for total RNAs using Simply P Total RNA Extraction Kit (Bioflux, Zhejiang, China). The vRNA and mRNA were reverse transcribed using PrimeScript RT reagent Kit with gDNA Eraser (Takara, China) with the NS-specific primer RT-vRNA-NS and oligo(dT), respectively, followed by quantitative-PCR using Fluc-specific and Rluc-specific qPCR primers. The relative level of Fluc were normalized to Rluc for vRNA, mRNA as well as luciferase activity were calculated to reflect the efficacy of vRNA replication, transcription and protein expression of indicated minigene constructs. Alternatively, the natural or modified NS segments expressing plasmids were separately co-transfected with natural M-expressing plasmid (pPolI-M) into 293T cells expressing RdRp constituents. After 24h incubation, the cells were harvested for total RNA extraction. The vRNA and mRNA were reverse transcribed as described above, except for vRNA M were reverse transcribed using a universal 3’NCR primer RT-3’NCR, followed by qPCR using NS-specific and M-specific qPCR-primers. The vRNA and mRNA level of NS-derived segments were normalized to those of M to reflect their replication and transcription efficacy respectively. The primers used for reverse transcription and qPCR were shown in supplementary S2 Table. In vitro growth curves MDCK cells growing in 6 well plates were infected by indicated viruses at a multiplicity of infection (MOI) of 0.01 TCID 50 /cell. After 1 h incubation at 37°C, cells were washed and fresh Opti-MEM containing 2 μg/ml TPCK-trypsin were added. Aliquots were removed at various time points for viral titration and luciferase assays. Luciferase assays To determine the activity of Gluc, 50 μL of viral culture medium or lung tissue homogenate (appropriate dilution applied to avoid over range) were mixed with 50 μL of luciferase substrate using Pierce Gaussia Luciferase Flash Assay Kit (Thermo Scientific, Rockford, IL, USA) according to the manufacturer’s instructions. The luminescence was detected immediately using Sirius L Tube Luminometer (Berthold, Germany). Fluc assays were performed using a Britelite plus Reporter Gene Assay System (PerkinElmer, Waltham, MA, USA) according to the manufacturer’s instructions. In brief, MDCK cells growing in 96 well plates were infected by indicated viruses at an MOI of 0.01. After 1 h incubation at 37°C, cells were washed and fresh Opti-MEM containing 2 μg/ml TPCK–trypsin were added. At 24 h post infection (p.i.), the culture medium was discarded, followed by sequentially adding 50 μL PBS and 50 μL substrate. After incubation for 10min, the luminescence was detected immediately using BioTek SYNERGY neo2 Microplate Reader (BioTek, Winooski, VT, USA). Genome stability analysis The indicated recombinant IAVs were serially passaged in chicken embryos for at least five passages. The viruses of each passage were tittered and used to infect MDCK cells grown in white 96-well plates (10,000 cells/well) at an MOI of 0.1. The cells were harvested at 24 h.p.i. for luciferase assays. Animal models Female BALB/c mice (4 to 6 weeks old) were used in this study. All animals were maintained under specific pathogen-free conditions and all efforts were made to minimize any suffering and the number of animals. To determine the lethality of the viruses, five mice from each group were inoculated intranasally under isoflurane anesthesia with 10-fold serial dilutions containing 100 to 105 TCID 50 (30 μl) of virus. Body weight and survival were monitored daily for 14 days. To measure virus replication in mice, three to six mice in each group were inoculated intranasally under isoflurane anesthesia with indicated sublethal dose of viruses. At indicated time points, mice were subjected to in vivo imaging, ex-vivo imaging or determination of viral load/luciferase activities in lung tissues. For antiviral treatments, 10–30 mg/kg/day of oseltamivir phosphate or vehicle only (PBS) were administered via intraperitoneal (i.p.) injection. The treatments were given twice daily for 5 days starting at 2 h before virus inoculation. Ex-vivo imaging Mice infected with sublethal doses of PR8-NS-Gluc, PR8-NSCE1-Gluc or mock infected were euthanized on day 3 p.i. and the trachea and lungs were excised. A syringe needle was inserted into the opening of the trachea and 0.5 ml of coelenterazine (50 μg/ml, NanoLight Technology, AZ, USA) was injected into the lung, followed by imaging immediately using IVIS200. In-vivo imaging Mice infected with varies doses of PR8-NSCE2-Fluc or X31-NSCE2-Fluc were anaesthetized and the substrate D-Luciferin (PerkinElmer, Waltham, MA, USA) was injected intraperitoneally at 150 mg/kg. At 10 min after substrate administration, images were acquired with the Xenogen IVIS 200 and analyzed using the Living Image software (version 4.4). To measure virus replication, live imaging was conducted daily, while for antiviral determination, the imaging were conducted on days 2 and 5 p.i. Statistical analysis For PR8-NSCE1-Gluc based high-throughput screening approach, the quality was assessed by evaluation of the signal-to-noise (S/N) ratio, coefficient of variation (CV) and Z’ factors. (1) S/N = mean signal of negative control / mean signal of positive control; (2) CV = SD of negative control / mean of negative control; (3) Z’ = 1–3 × (SD of positive control + SD of negative control) / (mean of negative control—mean of positive control). SD represents the standard deviation. A Z’ value between 0.5 and 1.0 is considered robust enough for an HTS assay. Statistical significance was determined using unpaired Student’s t-test with two-tailed analysis and the GraphPad Prism 5 software package (GraphPad Software). Data are considered significant when P values are<0.05.

Supporting information S1 Fig. The effects of panhandle-stabilizing mutations on vRNA transcription. The indicated NS-derived vRNAs were separately subjected to dual competition assay with wildtype M as competitive control. Data represents the relative mRNA levels of wildtype M, NS and normalized NS/M. *, p<0.05; **, p<0.01; ***, p<0.001; ns, no significance; students’ t test. https://doi.org/10.1371/journal.ppat.1010756.s001 (TIF) S2 Fig. Genomic stability analysis. (A) The indicated reporter viruses were serially passaged in chicken embryos and the titer of each passage was determined. Error bars indicated Mean ± SEM of three independent experiments. (B) The genome RNAs of indicated recombinant viruses were extracted using TIANamp Virus RNA Kit (Tiangen, China). The complementary DNA was prepared using PrimeScript RT reagent Kit with gDNA Eraser (Takara, China) and NS segment specific primer (5’-CAGGGTGACAAAGACATAATG-3’). Then PCR analysis was performed using the 2xTaq MasterMix (Cwbio, China) and primers covering the full length of firefly luciferase gene (NS-Fluc-specific-Forward:5’-ACGTCGAGGAGAATCCCGGGCCCATGGAAGACGCCAAAAA-3’; NS-Fluc-specific-Reverse: CAGGCTAAAGTTGGTCGCGCCGCTGCCCAATTTGGACTTT). The PCR product was analyzed using 1% agarose gel electrophoresis. The plasmids pPolI-NSCE1-Fluc and pPolI-NSCE2-Fluc were used as positive controls, while pPolI-NS was used as the negative control. https://doi.org/10.1371/journal.ppat.1010756.s002 (TIF) S3 Fig. Deep sequencing analysis. The viral RNA of PR8-NSCE2-Fluc (Passage 5) was extracted using SparkZol reagent (SparkJade, China) according to the manufacturers manual and sequentially subjected to first and second strand cDNA synthesis using BeyoRT II First Strand cDNA Synthesis Kit (RNase H-) and Second Strand cDNA Synthesis Kit (Beyotime, China). The double stranded cDNA library of virus genome was deep sequenced by Novogene (China) using Illumine nova 6000. Structural variation (SV) analysis by BreakDancer software (V1.4.4, http://breakdancer.sourceforge.net/) detected no insertion, deletion, inversion and translocation of the large segments in the genome level, While SNP/InDel analysis using SAMTOOLS identified two substitutions but no insertion/deletion. (A) The depth of sequencing to positions along the reference genome. (B) Identification and characterization of the mutations. https://doi.org/10.1371/journal.ppat.1010756.s003 (TIF) S1 Table. Primers for construction of the plasmids. a The substitutions at indicated positions are shown in red. https://doi.org/10.1371/journal.ppat.1010756.s004 (DOCX) S2 Table. Primers for reverse transcription and qPCR analysis. https://doi.org/10.1371/journal.ppat.1010756.s005 (DOCX)

Acknowledgments We thank Prof. Dongmei Qi and Dr. Xiwen Geng from Experiment Center of Shandong University of Traditional Chinese Medicine for their technical support.

[END]
---
[1] Url: https://journals.plos.org/plospathogens/article?id=10.1371/journal.ppat.1010756

Published and (C) by PLOS One
Content appears here under this condition or license: Creative Commons - Attribution BY 4.0.

via Magical.Fish Gopher News Feeds:
gopher://magical.fish/1/feeds/news/plosone/

You are viewing proxied material from magical.fish. The copyright of proxied material belongs to its original authors. Any comments or complaints in relation to proxied material should be directed to the original authors of the content concerned. Please see the disclaimer for more details.