(C) PLOS One [1]. This unaltered content originally appeared in journals.plosone.org.
Licensed under Creative Commons Attribution (CC BY) license.
url:https://journals.plos.org/plosone/s/licenses-and-copyright

------------



Molecular studies into cell biological role of Copine-4 in Retinal Ganglion Cells

['Manvi Goel', 'Retinal Circuit Development', 'Genetics Unit', 'Neurobiology Neurodegeneration', 'Repair Laboratory', 'Nei', 'National Institutes Of Health', 'Bethesda', 'Maryland', 'United States Of America']

Date: 2021-12

The molecular mechanisms underlying morphological diversity in retinal cell types are poorly understood. We have previously reported that several members of the Copine family of Ca-dependent membrane adaptors are expressed in Retinal Ganglion Cells and transcriptionally regulated by Brn3 transcription factors. Several Copines are enriched in the retina and their over-expression leads to morphological changes -formation of elongated processes-, reminiscent of neurites, in HEK293 cells. However, the role of Copines in the retina is largely unknown. We now investigate Cpne4, a Copine whose expression is restricted to Retinal Ganglion Cells. Over-expression of Cpne4 in RGCs in vivo led to formation of large varicosities on the dendrites but did not otherwise visibly affect dendrite or axon formation. Protein interactions studies using yeast two hybrid analysis from whole retina cDNA revealed two Cpne4 interacting proteins–Host Cell Factor 1 and Morn2. Mass Spectrometry analysis of retina lysate pulled down using Cpne4 or its vonWillebrand A domain showed 207 interacting proteins. A Gene Ontology analysis of the discovered proteins suggests that Cpne4 is involved in several metabolic and signaling pathways in the retina.

This is an open access article, free of all copyright, and may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose. The work is made available under the Creative Commons CC0 public domain dedication.

In the retina, we have previously reported that Cpne4, 5, 6 and 9 are enriched in the inner retina and they are regulated by Brn3b and Brn3a [ 10 , 31 ]. Whereas Cpne5, 6 and 9 were expressed in most of the Ganglion Cell Layer (GCL) as well as the Inner Nucelar Layer (INL), Cpne4 is the only Copine specifically expressed in RGCs (with the exception of one INL amacrine cell type) [ 31 ]. Using over-expression studies in HEK293 cells, we found that Copines can significantly alter cell morphology, inducing elongated membrane processes. A previous study had investigated the potential interacting proteins for Cpne1, 2 and 4 using yeast two hybrid (Y2H) analysis on a mouse embryonic cDNA library [ 32 ]. In the current study, we further explore the effects of Cpne4 expression in RGCs and study its protein interactions using a Y2H analysis using retina cDNA library and Mass Spectrometry on total retina lysate, to identify its cell biological functions and role in RGCs.

In the nervous system, Copines were first seen to be localized in hippocampus and olfactory bulb neurons in mouse brain [ 18 , 25 ]. Cpne6 is expressed in the hippocampus and is required for regulating the spine morphology during long term potentiation in hippocampus by regulating the Rac-LIMK-Cofilin and BDNF-TrkB pathways [ 26 , 27 ]. Cpne1 has been previously seen to be upregulated during development and is required for hippocampal progenitor cell differentiation into neurons [ 28 , 29 ]. Cpne7 is expressed in sublaterodorsal nucleus in pontine segmental area and is required for rapid eye movement (REM) sleep [ 30 ].

Copines are conserved across several species. They have previously been shown to be important in a variety of cellular functions. Copines are involved in myofilament stability in C. elegans and plant growth in Arabidopsis [ 21 , 22 ]. Copines are also involved in cytokinesis and contractile vacuole function by regulating cAMP signaling in Dictyostelium[ 23 ]. Copine A has also been shown to interact with actin filaments to regulate chemotaxis and adhesion in Dictyostelium[ 24 ].

There are nine Copines in mammals- Cpne1- 9 [ 12 , 16 – 18 ]. Of these, Cpne1, 2 and 3 are expressed ubiquitously. Cpne4, 5, 6, 7, 8 and 9 are enriched in neurons. Cpne5 and 8 are also expressed in other tissues such as kidneys, lungs, testes and mammary glands [ 19 , 20 ].

How cell-specific morphologies develop in the retina is not well understood. One likely mechanism is that transcription factors encode specific morphological features via adhesion molecules or cytoskeletal elements they regulate. For example, Tbr1 regulates cell adhesion molecules Cdh8 and Sorcs3 resulting in dendritic stratification of JamB + RGCs in the Off sublamina [ 11 ]. Other such molecules might be responsible for cell specific morphologies in other RGC types. Copines are a family of such candidate cell morphology determinants, regulated by Brn3 transcription factors. Copines consist of two C2 domains (C2A and C2B) and a vonWillebrand A (vWA) domain [ 12 , 13 ]. The Copine C2 domains are similar to those found in a variety of vesicular traffic proteins such as Synaptotagmins, Munc18, Rabphilin3A and Doc2, and have been involved in calcium dependent binding to cell membranes [ 14 ]. vWA domains are typically found extracellularly in several proteins (e.g., integrins) and are involved in protein-protein interactions [ 15 ]. However, Copines (and their vWA domain) are intracellular proteins that interact transiently with the inner leaflet of the plasma membrane.

Retinal Ganglion Cells (RGCs) in the retina transmit visual signals received by photoreceptors to the brain for processing visual inputs. Different RGC sub-types are responsible for computing different aspects of the visual stimuli. The combinatorial expression of transcription factors in different RGC sub-types regulates cell specific morphologies and physiology by controlling molecules involved in the development of dendrite/axon morphology, synapse formation and function [ 1 – 10 ].

2. Materials and methods

2.1 Transfection in HEK293 cells The cDNA for full length Cpne4, two C2 domain or vWA domain were cloned into pAAV-FLEX-HA-T2A-meGFP plasmid vector (Fig 1A). The cDNA is in frame with 3XHA (3 tandem copies of Hemagglutinin or HA antigen tag- 5’TACCCATACGATGTTCCAGATTACGCT 3’ or 5’TATCCATATGATGTTCCAGATTATGCT 3’) and separated from membrane enhanced green fluorescent protein (meGFP) by a P2A peptide sequence. The constructs were transfected into human embryonic kidney 293 cells expressing Cre (HEK293Cre) using Lipofectamine (Invitrogen, Carlsbad, CA). The transfected cells were fixed in 2% paraformaldehyde (PFA) after 48 hours and processed for immunofluorescence as described in section 2.4. PPT PowerPoint slide

PNG larger image

TIFF original image Download: Fig 1. Cpne4 and Cpne4 dominant negative transfections in HEK293. (A) Map of the Flex construct. (B) Map of domain structure of Cpne4 shows three domains of the Cpne4 protein- two C2 domains (blue) and a vWA domain (purple). The location of the three Cpne4 plasmid constructs are shown for full length Cpne4 construct (orange), vWA domain construct (brown) and C2 domains construct (green). The binding of the two Cpne4 antibodies- N-terminal and C-terminal antibodies on the Cpne4 protein are indicated by yellow triangles. (C) Representative images of HEK293 cells transfected with expression constructs for full length Cpne4 (top row), C2 domains construct (middle row) and vWA domain construct (bottom row). The cells were counterstained for eGFP (green), HA (red) and N-terminal or C-terminal Cpne4 (white) antibodies and nuclear marker DAPI (blue). (D) Morphometric analysis showing aspect ratios of an ellipse fitted to the cells calculated for Cpne4, vWA domain and C2 domains transfected cells. The boxes show interquartile intervals with the median indicated with a red line and the whiskers represent the range of the observations. The mean and median aspect ratios for each group and p-values of comparisons of vWA domain and C2 domains transfected cells to Cpne4 transfected cells are given in Table 2.***, p< 0.001. Scale bar: 50μm. https://doi.org/10.1371/journal.pone.0255860.g001

2.2 Mouse lines Adult Brn3bKO/KO (or Brn3b KO: Brn3b knockout) [33] and Brn3bW/WT (or Brn3b WT or WT: wild-type) littermates were used for immunohistochemistry (IHC). Postnatal day 0 (P0) or P14 Brn3bCre/WT mice were used for AAV1 virus infections. Adult wild-type (C57/Bl6 –SV129 mixed background) mice were used for retina pulldowns and mass spectrometry experiments, to determine the protein interactors of Cpne4. All animal procedures were approved by the National Eye Institute (NEI) Animal Care and Use Committee under protocol NEI640.

2.3 Virus infections in retina Flex-meGFP-P2A-HA-Cpne4, described in section 2.1, was packaged into adeno-associated virus 1 (AAV1, henceforth AAV1-Cpne4). Postnatal 0 (P0) or P-15 Brn3bCre/WT mice were used for these experiments. P0 pups were anesthetized on ice for 30 seconds and a slit was cut in the eye lid. Intraocular injections of 0.5 ìl (1e9 viral particles/ìl) of AAV1-Cpne4 or AAV1-eGFP control virus were done in the eyes using pulled glass capillaries fitted onto a Femtojet device (Eppendorf, Enfield, CT), as previously described [1]. Injections were aimed at the scleral region adjacent to the limbus. P-15 mice were anesthetized with 100 mg/kg ketamine and 10 mg/kg xylazine before intraocular injections. Both P0 and P-15 pups were returned to their mothers after the experiments. Intraocular injections do not have systemic effects, and the injections in pups heal rapidly. If necessary, the corneal surfaces were flushed with a dilute betadine-saline solution and triple ophthalmic ointment was applied after the procedure. Animals were monitored daily by the investigators and the facility care staff for up to 5 days for signs of eye infection. General health of the mice was observed daily until euthanasia. The mice were euthanized and eyes were collected at 2–3 months of age (adult animals) and flat-mounted for immunostaining. The eyes were fixed in 4% paraformaldehyde for 15 minutes and retinas were dissected to make a flat mount preparation. The retinas were again fixed for 30 minutes and then washed three times with phosphate buffered saline+ 0.5% Triton-X 100 (PBST). Immunofluorescence was performed as described below. Total number of animals used (1 retina was used per animal) for this experiment is given in section 3.2.

2.4 Immunofluorescence Brn3b WT and KO sections were co-immunostained to confirm the presence of different interactor proteins identified from Y2H and mass spectrometry analysis in the retinal ganglion cells. Similar process was followed for immunofluorescence of transfected HEK293 cells on coverslips. The sections or cells were incubated with blocking solution- 10% bovine serum albumin (BSA), 10% normal donkey serum (NDS) and 0.5% Triton X 100, for one hour at room temperature. The blocking solution was then replaced with primary antibody solution containing the antibodies at the required concentrations and incubated overnight, at 4°C. Sections or cells were washed three times with PBST and incubated with the secondary antibody solutions for one hour at room temperature. The sections or cells were washed again with PBST and coverslipped. For staining the AAV1 infected retina flatmounts, the retinas were incubated in blocking solution, overnight at 4°C. The blocking solution was then replaced with primary antibody solution and retinas incubated for 48 hours at 4°C. The retinas were then washed three times in PBST, secondary antibody solution was added, and retinas were incubated overnight at 4°C. The retinas were washed again three times with PBST, carefully mounted on glass slides and coverslips were placed. Image acquisition was on either a Axioimager Z2 fitted with an apotome device, or on a LSM 880 confocal microscope (both from Zeiss, White Plains, NY). The images were taken as 1 ìm thick z-stacks, and the images were stacked using ImageJ. Colocalization analysis of Copine4-interacting proteins in HEK293 cells was performed using the “Coloc 2” plugin in ImageJ. All details of primary antibodies used are given in Table 1. PPT PowerPoint slide

PNG larger image

TIFF original image Download: Table 1. List of antibodies used for immunofluorescence and WB. https://doi.org/10.1371/journal.pone.0255860.t001

2.5 Yeast two hybrid (Y2H) analysis A Gal4 based Y2H analysis was performed to identify the proteins that interact with Cpne4 vWA domain. An adult mouse retina cDNA library was cloned in pGADT7 (carrying a Trp1 selection gene) and transformed into AH109 yeast strain (containing His3, Ade2, lacZ and Mel1 selections; Clontech, BD Biosciences, Pao Alto, CA). Cpne4 vWA domain was cloned into pGBKT7 (carrying Leu2 selection gene) and transformed into competent Y187 yeast strain (lacZ and Mel1 selection). The yeast mating experiment was performed as per the Two-hybrid library screening protocol for yeast mating (Clontech). Briefly, one colony of Y187 transformed with pGBKT7+ Cpne4 vWAdomain was inoculated in 50 ml of Tryptophan (Trp) selection media and incubated at 30°C overnight. The following day, the culture media was centrifuged, and the pellet re-suspended in 5ml Trp selection media. 45ml of YPDA media (Yeast extract Peptone Dextrose media supplemented with adenine(Ade)) was added to it. 1ml of cDNA library (titer = 5 x 107 cfu/ml) was thawed in a water bath at room temperature and added to the above and allowed to mate for approximately 24 hours at 30°C with slow shaking at 50 rpm. The next day, the presence of mated, diploid yeast cells was checked under a light microscope. The culture was then centrifuged, and the pellet resuspended in 15 ml 0.5X YPDA. 300ul aliquots of the entire 15 ml mating culture was spread on 15 cm quadruple selection agar plates (with selection for Trp, leucine (Leu), Ade and histidine (His) and X-alpha-Gal reporter) and grown for about 5 days at 30°C. Small scale positive and negative control matings were also performed. For positive control, pGBKT7-53 encoding the p53 protein and pGADT7-T encoding the SV40 large T antigen protein were transformed into Y187 and AH109, respectively. For negative control, empty pGBKT7 and pGADT7, with no gene insertions, were transformed into Y187 and AH109, respectively. For the positive control mating, one colony each from Y187 + pGBKT7-53 and AH109 + pGADT7-T were inoculated in 500ul 2X YPDA and incubated overnight at 30 degrees at 200rpm. Similarly, for the negative control mating, Y187 + empty pGBKT7 and AH109 + pGADT7 were inoculated in 500ul 2X YPDA and incubated overnight at 30 degrees at 200rpm. The following day the control cultures were spread in 1:10, 1:100 and 1:1000 dilutions on separate single (Leu or Trp), double (Leu and Trp) or quadruple selection agar plates and grown for 3–5 days at 30°C. After 4 days of selection, 241 pale blue colonies were picked for confirmation. They were streaked separately on fresh agar plates with quadruple selection. Six colonies grew into blue colonies after 3–4 days. For both positive and negative controls, the colonies appeared on the single selection and double selection plates. But on the quadruple selection plates, blue colonies appeared only on positive control and there were no colonies for negative control. Colony polymerase chain reaction (PCR) was performed on the six selected colonies, and PCR products were extracted from the gel and Sanger sequenced (Eurofins, Luxembourg). Inserts were identified by BLAST (basic local alignment search tool)search against the NCBI mouse transcriptome database.

2.6 Co-immunoprecipitation HEK293 cells were co-infected with HA-eGFP-Cpne4-vWAdomain construct (described in section 2.1) and Flag- tagged target protein or protein domain identified from Y2Hanalysis. 24 hours after the transfection, the cells were washed three times with 1X PBS. 300 ìl lysis buffer (50mM Tris-HCl, 150mM NaCl, 0.5% NP40 and 1mM ethylenediaminetetraacetic acid (EDTA)) containing protease inhibitor (Roche, Basel, Switzerland) and 0.2M phenylmethylsulfonyl fluoride was added to each well and incubated on ice for 15 minutes. The lysate was then collected in 1.5ml tubes and centrifuged at 14000g for 10 minutes to remove any debris. Meanwhile, magnetic beads were washed with 1X PBS and incubated with Flag antibody for 30 minutes, with end-to-end rotation at 4°C. The beads were again washed with 1X PBS to remove any unbound antibody and the supernatant from the cell lysate was added to it. These were incubated overnight with end-to-end rotation at 4°C. The next day, the beads were washed four times and PBS + Laemmli buffer (62.5mM Tris-HCl, 2% Sodium Dodecyl Sulfate (SDS), 10% glycerol, 5% beta-mercapto-ethanol, bromophenol blue) was added to the beads. The beads were boiled for 5 minutes at 70°C. The beads were separated on a magnetic rack and the supernatant loaded on a 10% SDS-Polyacrylamide gel electrophoresis (SDS-PAGE) gel. The gel was allowed to run until the dye front reached the bottom of the gel. The separated proteins were then transferred to 0.2 μm polyvinylidene difluoride (PVDF) membranes and processed further for Western blotting.

2.7 GST pulldown from retina Glutathione S- transferase (GST) tagged Cpne4 protein was synthesized from bacteria as described before [31]. GST tagged Cpne4-vWAdomain (GST-Cpne4-vWA) and GST proteins were also synthesized similarly. 19 wild-type retinas (C57Bl6 and SV129) were homogenized using a glass homogenizer, in cold lysis buffer (RIPA buffer: 50mM Tris-HCl, 150mM NaCl, 1mM EDTA, Complete protease inhibitor (Millipore Sigma, Burlington, MA; Catalog no. 11697498001)). NP40 was then added to the lysate to a 0.5% final concentration. Glutathione- tagged magnetic beads were added to the lysate and incubated at 4 degrees with end-to-end rotation for 2 hours. The magnetic beads were removed, and the lysate centrifuged at 700 g for 10 minutes to remove any debris. The lysate was then kept on ice until further process. Equimolar amounts of GST, GST-vWA domain and GST-Cpne4 were incubated with glutathione tagged magnetic beads and incubated with end-to-end rotation at 4°C for 2 hours. The supernatant was discarded, and beads washed three times with PBS. Equal volume of cleared retina lysate (600 ìl each) was added to each of the above three tubes and incubated overnight at 4°C with end-to-end rotation. The following day, the supernatant was discarded, and the beads were washed four times with PBS. 30 ul of glutathione elution buffer was added to each of the tubes and incubated at room temperature for 10 minutes with end-to-end rotation. Laemmli buffer was added, and the samples boiled at 70°C for 5 minutes. The beads were separated, and the samples loaded onto 4–15% gradient SDS-PAGE gels. The samples were allowed to run on the gel until the dye front reached the bottom and proteins were visualized using Coomassie blue staining. Full lanes were cut out of the gel for each of the three samples, cut into smaller band size pieces and collected in separate tubes. Three such replicates were prepared each for GST, GST-Cpne4-vWAdomain and GST-Cpne4 pull-downs. The cut bands were then processed further for liquid chromatography mass spectrometry (LC-MS). An additional three replicates also prepared similarly, transferred to PVDF membranes directly after SDS-PAGE and checked with specific antibodies by western blotting. See the section on western blotting for further details.

2.8 Mass spectrometry For sample preparation for LC-MS, Coomassie blue stained protein gel bands were first de-stained with 30% ethanol solution until the gel pieces became transparent. The gel pieces were then de-stained in 65% methanol + 10% acetic acid solution for 30 minutes. The destaining solution was removed and bands were washed with 100 mM triethyl ammonium bicarbonate (TEAB) solution for 5 minutes. 250 ul dehydration solution (75% acetonitrile in 100 mM TEAB) was added and the bands were agitated for 10 minutes at room temperature. The dehydration solution was removed, and the bands were air-dried for a couple of minutes. The gel pieces were then dehydrated with reducing solution (10 mM Tris(2-carboxyethyl)phosphinein 100 mM TEAB) for 45 minutes at 56°C. This solution was replaced by dehydration solution and bands incubated for 10 minutes at room temperature. The bands were then air dried and alkylation solution (20 mM iodoacetamide in 100 mM TEAB) was added and incubated for 30 minutes at room temperature. The gel bands were washed again and dehydrated again in the dehydration solution until the gel bands shrunk to half the size. The gel bands were air dried briefly and a trypsin solution was added to the bands, enough to cover the bands. The bands were left on ice for 5 minutes and more trypsin was added as needed. After 5 minutes, the trypsin solution was removed and 100 mM TEAB was added to tubes, enough to cover the bands. The tubes were incubated at 37°C for overnight digestion. The next day, the trypsin solution was removed, and digested peptides transferred to new tubes separately for each sample. 150ul of extraction solution (75% acetonitrile, 0.1% formic acid) was then added to each of the tubes and agitated for 10 minutes at room temperature. A short spin was done at 10,000 g and the gel pieces were saved. The extracts were then vacuum dried and 25 ul 1% trifluoroacetic acid was added to each tube. This was followed by a peptide clean-up as per the zip-tip protocol (Millipore Sigma; Catalog number C18 ZTC18S008). 20ul of 0.1% formic acid (in acetonitrile) was aspirated in the zip-tip and discarded. 20ul of 0.1% formic acid (in water) was similarly aspirated and discarded. The peptide extract was then aspirated 7–10 times, to let the peptides bind to the zip-tip column. This was followed by washing the zip-tip three times by aspiring 20 ìl of wash solution (0.1% formic acid in water) and dispensing it. To elute the bound peptides, 20 ìl of elution buffer (75% acetonitrile + 0.1% formic acid) was aspirated and dispensed in a tube. This step was repeated five times and each time eluate was collected in the same tube. The tubes were then dried in a speed vacuum. 20ul of 2% acetonitrile + 0.1% formic acid solution was added to the dried peptide digest and the tubes were vortexed and centrifuged. The solution was then transferred to LC vials for LC-MS analysis. Desalted tryptic peptides were analyzed using nanoscale liquid chromatography tandem mass spectrometry (nLC- MS) and Ultimate 3000-nLC online coupled with an Orbitrap Lumos Tribrid mass spectrometer (Thermo Fisher Scientific, Waltham, MA). Peptides were separated on an EASY-Spray Column (Thermo Fisher Scientific; 75 mm by 50 cm inner diameter, 2-mm particle size, and 100-Å pore size). Separation was achieved by 4 to 35% linear gradient of acetonitrile + 0.1% formic acid for 90 minutes. An electrospray volt- age of 1.9 kV was applied to the eluent via the EASY-Spray column electrode. The Orbitrap Lumos was operated in positive ion data- dependent mode. Full-scan MS was performed in the Orbitrap with a normal precursor mass range of 380 to 1500 m/z (mass/charge ratio) at a resolution of 120,000. The automatic gain control (AGC) target and maximum accumulation time settings were set to 4 × 105and 50 ms, respectively. MS was triggered by selecting the most intense precursor ions above an intensity threshold of 5 × 103for collision-induced dissociation (CID)–MS fragmentation with an AGC target and maximum accumulation time settings of 5 × 103 and 300 ms, respectively. Mass filtering was performed by the quadrupole with 1.6 m/z transmission window, followed by CID fragmentation in the ion trap (rapid mode) and collision energy of 35%. To improve the spectral acquisition rate, parallelizable time was activated. The number of MS spectra acquired between full scans was restricted to a duty cycle of 3seconds. Raw data files were processed with the Proteome Discoverer software (v2.4, Thermo Fisher Scientific), using Sequest HT (Thermo Fisher Scientific) search node for carbamylated peptide/protein identifications. The following search parameters were set: protein database UniProtKB/Swiss-ProtMus musculus (17,033 sequences release 2020_10) concatenated with reversed copies of all sequences; MS1 tolerance of 12 ppm: ion trap detected MS/MS mass tolerance of 0.5Da; enzyme specificity set as trypsin with maximum two missed cleavages; minimum peptide length of 6 amino acids; fixed modification of Cys residues (carbamidomethylation); variable modification of methionine oxidation and acetyl on N terminus of protein. Percolator algorithm (v.3.02.1, University of Washington) was used to calculate the false discovery rate (FDR) of peptide spectrum matches (PSM), set to a q-value <0.05) In order to identify retinal proteins that bind differentially to full-length Cpne4 or Cpne4-vWA domain, we compared the peptides pulled down by either GST-Cpne4-vWA, GST-Cpne4 or GST alone (as a control) and identified in the previous step. Of the 2119 proteins pulled down in either of the three conditions, we selected for further analysis those that were represented in all three replicates of at least one condition. Differential display analysis was performed using the R package “DEP” (DEP 1.12.0, 10.18129/B9.bioc.DEP; [34]). Missing values were replaced with 0, and data was normalized using VSN normalization. Pairwise comparisons for GST vs. GST-Cpne4 and GST-Cpne4-vWA samples were performed at thresholds of 0.05 FDR and 2-fold change.

2.9 Western blotting Western blotting (WB) was done as described before [23]. Briefly, the PVDF membranes were washed with Tris buffered saline with 0.1% Tween20 (TBST). The membranes were then incubated in 5% milk (in TBST) for 1 hour at room temperature. Primary antibody solution prepared in 5% milk was added to the respective membranes and incubated overnight at 4C on a rocker shaker. The next day, the membranes were washed three times in TBST and secondary antibody solution (in 5% milk) was added. The membranes were then incubated at room temperature for 1 hour, followed by three washes with TBST. The membranes were exposed to Super signal chemiluminescence (Thermo Fisher Scientific) for 5 minutes and images taken on a gel dock (Bio-Rad, Hercules, CA). The details of primary antibodies used are given in Table 1.

[END]

[1] Url: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0255860

(C) Plos One. "Accelerating the publication of peer-reviewed science."
Licensed under Creative Commons Attribution (CC BY 4.0)
URL: https://creativecommons.org/licenses/by/4.0/


via Magical.Fish Gopher News Feeds:
gopher://magical.fish/1/feeds/news/plosone/

You are viewing proxied material from magical.fish. The copyright of proxied material belongs to its original authors. Any comments or complaints in relation to proxied material should be directed to the original authors of the content concerned. Please see the disclaimer for more details.