(C) PLOS One [1]. This unaltered content originally appeared in journals.plosone.org.
Licensed under Creative Commons Attribution (CC BY) license.
url:https://journals.plos.org/plosone/s/licenses-and-copyright

------------



A CENH3 mutation promotes meiotic exit and restores fertility in SMG7-deficient Arabidopsis

['Claudio Capitao', 'Gregor Mendel Institute', 'Austrian Academy Of Sciences', 'Vienna', 'Sorin Tanasa', 'Central European Institute Of Technology', 'Ceitec', 'Masaryk University', 'Brno', 'Czech Republic']

Date: 2021-12

Abstract Meiosis in angiosperm plants is followed by mitotic divisions to form multicellular haploid gametophytes. Termination of meiosis and transition to gametophytic development is, in Arabidopsis, governed by a dedicated mechanism that involves SMG7 and TDM1 proteins. Mutants carrying the smg7-6 allele are semi-fertile due to reduced pollen production. We found that instead of forming tetrads, smg7-6 pollen mother cells undergo multiple rounds of chromosome condensation and spindle assembly at the end of meiosis, resembling aberrant attempts to undergo additional meiotic divisions. A suppressor screen uncovered a mutation in centromeric histone H3 (CENH3) that increased fertility and promoted meiotic exit in smg7-6 plants. The mutation led to inefficient splicing of the CENH3 mRNA and a substantial decrease of CENH3, resulting in smaller centromeres. The reduced level of CENH3 delayed formation of the mitotic spindle but did not have an apparent effect on plant growth and development. We suggest that impaired spindle re-assembly at the end of meiosis limits aberrant divisions in smg7-6 plants and promotes formation of tetrads and viable pollen. Furthermore, the mutant with reduced level of CENH3 was very inefficient haploid inducer indicating that differences in centromere size is not the key determinant of centromere-mediated genome elimination.

Author summary Meiosis is a reductional cell division that halves number of chromosomes during two successive rounds of chromosome segregation without intervening DNA replication. Such mode of chromosome segregation requires extensive reprogramming of the cell division machinery at the entry to meiosis, and inactivation of the meiotic program upon the formation of haploid spores. Here we showed that Arabidopsis partially deficient in the RNA decay factor SMG7 fail to exit meiosis and continue with attempts to undergo additional cycles of post-meiotic chromosome segregations without genome replication. This results in a reduced number of viable pollen and diminished fertility. To find genes involved in meiotic exit, we performed a suppressor screen for the SMG7-deicient plants that re-gain fertility. We found that reducing the amount of centromeric histone partially restores pollen formation and fertility in smg7 mutants. This is likely due to inefficient formation of centromere-microtubule interactions that impairs spindle reassembly and re-entry into aberrant rounds of post-meiotic chromosome segregation.

Citation: Capitao C, Tanasa S, Fulnecek J, Raxwal VK, Akimcheva S, Bulankova P, et al. (2021) A CENH3 mutation promotes meiotic exit and restores fertility in SMG7-deficient Arabidopsis. PLoS Genet 17(9): e1009779. https://doi.org/10.1371/journal.pgen.1009779 Editor: Gregory P. Copenhaver, The University of North Carolina at Chapel Hill, UNITED STATES Received: April 12, 2021; Accepted: August 16, 2021; Published: September 30, 2021 Copyright: © 2021 Capitao et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability: All relevant data are within the manuscript and its Supporting information files. Funding: This work was supported from the European Regional Development Fund‐Project ‘REMAP’ (No. CZ.02.1.01/0.0/0.0/15_003/0000479 to K.R.), Doctoral School “Chromosome Dynamics” of the Austrian Science Fund (FWF W1238 to K.R. and O.M.S.), Vienna Science and Technology Fund (WWTF LS13-057 to O.M.S.) and the German Federal Ministry of Education and Research (Plant 2030, Project 031B0192NN, HaploTools, to I.L.). The core facility CELLIM of CEITEC is supported by MEYS CR (LM2018129 Czech-BioImaging). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Funders web sites: MEYS: https://www.msmt.cz/ Austrian Science Fund: https://www.fwf.ac.at/ Vienna Science and Technology Fund: https://www.wwtf.at/ German Federal Ministry of Education and Research https://www.bmbf.de/. Competing interests: The authors have declared that no competing interests exist.

Introduction A sexual life cycle consisting of alternating haploid and diploid life forms is the defining feature of eukaryotes. Entry into the haploid phase requires meiosis, a reductional cell division that forms four haploid cells from a single diploid precursor. It involves segregation of homologous chromosomes in the first meiotic division that is followed, without intervening DNA replication, by segregation of sister chromatids in the second meiotic division. In contrast to the mitotic cell division machinery, meiosis requires mechanisms for tethering homologous chromosomes via recombination in prophase I, sister kinetochore monoorientation and protection of centromeric cohesion in metaphase-anaphase I, and inhibition of DNA replication in interkinesis [1,2]. While the sequence of meiotic events is evolutionally highly conserved, regulation of meiosis and its position in the context of the life cycle differ across diverse phylogenetic units [3,4]. Meiosis in angiosperm plants occurs in megaspore and pollen mother cells located in pistils and anthers, respectively, and leads to the formation of haploid spores. Rudimentary multicellular gametophytes carrying male and female gametes are formed by subsequent mitotic divisions. A number of genes involved in induction, progression, and termination of the meiotic program have been identified in plants. Genes required for meiotic fate acquisition and progression through early meiotic events include the transcription factor SPOROCYTELESS, RNA binding protein MEL2, AMEIOTIC1/SWITCH1, and RETINOBLASTOMA RELATED1 [5–9]. Redox status and small-RNA-mediated gene silencing have also been implicated in establishing meiotic cell fate [10–12]. Entry into meiosis is further accompanied by the induction of genes required for core meiotic functions [13,14]. Progression through the meiotic cell cycle is driven by cyclin dependent kinases (CDKs), in Arabidopsis mainly by CDKA;1, the key CDK that is also required for mitosis [15]. CDKA;1 plays a role in regulating meiotic spindle organization, cytokinesis, as well as recombination and chromosome pairing [16–18]. CDKA;1 activity is modulated by several mechanisms to implement the meiotic program. CDK substrate specificity is determined through association with different cyclins. Several A- and B- type cyclins are expressed in Arabidopsis pollen mother cells (PMCs) [19] and CDKA;1 was found to interact with at least three of them. SOLO DANCERS (SDS) is a meiosis-specific cyclin that mediates phosphorylation of the chromosome axis assembly factor ASYNAPTIC 1 (ASY1) and is essential for homologous recombination and pairing [16,20]. A-type cyclin TARDY ASYNCHRONOUS MEIOSIS (TAM) and CYCB3;1 have been implicated in organization of the meiotic spindle and regulation of cell wall formation [16,19,21,22]. An important aspect of meiosis is the absence of S-phase in interkinesis between meiosis I and II. In yeasts and mammals, this is achieved via partial inhibition of the anaphase promoting complex (APC/C) after anaphase I, which results in residual CDK activity in interkinesis to prevent DNA replication. A similar mechanism was also suggested in Arabidopsis, where inactivation of the APC/C inhibitor OMISSION OF SECOND DIVISION 1 (OSD1) leads to premature meiotic exit after meiosis I [23,24]. Two genes have been implicated in terminating the meiotic program and enabling the transition to gametophytic development in Arabidopsis. THREE DIVISION MUTANT1 (TDM1)/MS5/POLLENLESS3 is a plant-specific gene that is exclusively expressed in meiocytes, and loss of its function results in male sterility [25–28]. Mutant PMCs fail to exit meiosis and the chromosomes of the haploid nuclei re-condense, nucleate four spindles, and attempt to undergo a third division [25,29]. Another gene required to terminate meiosis is SUPPRESSOR WITH MORPHOGENETIC EFFECTS ON GENITALIA7 (SMG7), an evolutionary conserved protein involved in nonsense-mediated RNA decay (NMD). Arabidopsis smg7-null mutants are NMD-deficient, exhibit stunted growth due to an upregulated immune response, and are infertile [30,31]. The infertility is caused by meiotic arrest in anaphase II and inability to exit meiosis. Analysis of plants with a hypomorphic smg7-6 allele that contains a T-DNA insertion in the diverged C-terminal domain of the gene indicate that the meiotic function of SMG7 is not connected to its role in NMD [32], but the mechanism of its action in meiosis remains unknown. We reasoned that mutations that restore fertility and increase pollen count in smg7-6 mutants might help identify genes that affect meiotic exit in Arabidopsis and therefore performed a genetic suppressor screen in this background. We identified two suppressor lines with a mutation in the CENH3 gene, which encodes the centromeric variant of histone H3. This mutation does not alter the amino acid sequence of the protein but leads to inefficient splicing of CENH3 mRNA and a substantial reduction of CENH3 protein levels. We describe the consequences of decreased CENH3 for meiosis, mitosis, and centromere-mediated induction of haploid plants.

Discussion Transition from meiosis to post-meiotic differentiation of haploid gametophytes is governed by a dedicated mechanism that requires the nonsense-mediated RNA decay factor SMG7 [30]. So far, the only molecular function assigned to SMG7 was related to NMD, where SMG7 binds to phosphorylated UPF1 via its N-terminal phosphoserine binding domain and mediates re-localization of UPF1-bound RNA to P-bodies [45]. In vertebrates, the C-terminal region of SMG7 further associates with the CCR4-NOT deadenylase to degrade aberrant mRNA. This mechanism also appears to be conserved in plants [46,47]. Nonetheless, two lines of evidence argue that the meiotic function of SMG7 in Arabidopsis is not implemented through NMD. First, Arabidopsis UPF1-deficient plants are more impaired in NMD than SMG7-null mutants [48], but they do not show a meiotic phenotype and produce viable pollen [32]. Second, the hypomorphic smg7-6 allele carrying a T-DNA insertion in the C-terminal region is NMD-proficient, but still exhibits meiotic defects [31,32]. We therefore conclude that SMG7 has an additional role in regulating meiotic exit, at least in the male pathway. We previously proposed that SMG7 directly or indirectly contributes to the downregulation of CDK activity at the end of meiosis [29]. Processes required for chromosome segregation, such as nuclear envelope breakdown, chromosome condensation, and spindle formation are driven by increasing activity of M-phase CDKs. Degradation of M-phase cyclins by the APC/C in anaphase and downregulation of CDKs revert these processes and allow cytokinesis, exit from the M-phase, and licensing of origins of replication for DNA synthesis in the next S-phase [49,50]. If CDK activity is not irreversibly downregulated, untimely chromosome re-condensation, spindle reassembly, and re-initiation of chromosome segregation might be consequences, as seen in tdm1 and smg7-6. The complete lack of pollen in tdm1 versus low numbers of viable pollen grains in smg7-6 could originate from differences in the degree of re-condensation: less condensed chromatin in tdm1 in the third division might preclude the formation of any chromosome cluster that would result in a functional microspore, while slightly stronger chromosome condensation at the respective state in smg7-6 could increase the chance of encapsulating the right chromosome combination for the occasional formation of viable pollen. This residual fertility in smg7-6 permitted a suppressor screen to identify genes whose mutations affect meiotic exit in Arabidopsis and increase production of viable pollen and seeds. Identifying a mutation, twice independently, in the gene for centromeric histone CENH3 that partially rescues infertility of smg7-6 plants came as a surprise. CENH3 is the key determinant of centromeric chromatin and kinetochore assembly. Its inactivation in Arabidopsis is embryonic lethal [40], and RNAi-mediated knock down of CENH3 mRNA to 27–43% of the wild type level was reported to cause dwarfism and severe developmental defects [51]. Although the cenh3-4 mutation leads to a 10-fold reduction of fully spliced CENH3 mRNA and depletion of CENH3 from centromeres, mutant plants do not exhibit growth abnormalities under standard conditions and are fully fertile. Immunolocalization of CENH3 and the inner kinetochore proteins CENP-C and KNL2 suggest that centromeres and kinetochores are smaller in cenh3-4 plants compared to wild type. These data indicate that plants can tolerate a substantial decrease of CENH3 level and centromere size. This has also been shown for centromeres on supernumerary B-chromosomes in maize that retained their functionality despite being trimmed to approximately 100 kb via chromosome fission [52]. How does the decreased level of CENH3 contribute to the restored fertility of smg7-6 plants? The most notable cytological effect of the single cenh3-4 mutant was delayed congression of mitotic chromosomes to the metaphase plate, suggesting less efficient establishment of a stable bipolar spindle. Chromosome congression and the bipolar spindle are formed by a search-and-capture mechanism in which microtubules initially establish lateral contacts with kinetochores that are later transformed into more stable attachments to the plus ends of microtubules [53,54]. The small kinetochores in cenh3-4 mutants may decrease the efficiency of kinetochore-microtubule interaction and increase the time required for spindle formation. Such size-dependent attachment of kinetochores was predicted by computational modelling [54] and supported by the observation that chromosomes with larger kinetochores acquire bi-polar orientation faster than chromosomes with smaller kinetochores [55]. Smaller kinetochores in the cenh3-4 smg7-6 double mutant PMCs could therefore reduce the degree or speed of aberrant meiotic divisions compared to smg7-6 single mutant plants. We propose that inefficient formation of centromere-microtubule interactions hinders spindle reassembly, re-entry into aberrant rounds of chromosome segregation, and thereby allows more efficient formation of viable pollen and higher fertility. Centromere-mediated genome elimination is a promising strategy for inducing haploid plants for various breeding applications [56]. This technology was developed in Arabidopsis where all chromosomes of mutants with structurally altered CENH3 are eliminated upon crossing with wild type [40–42,57]. The underlying mechanism is assumed to be based on postzygotic incompatibility, whereby the parental chromosome set with the structurally altered CENH3 at its centromeres is mitotically unstable and therefore is left behind in early embryonic divisions [40,58,59]. It was hypothesized that CENH3 mutations may impair chromatin loading, forming smaller centromeres that cannot compete with the larger centromeres of the crossing parent [44], causing early loss of chromosomes due to size dimorphism of parental centromeres. Indeed, genome elimination can be induced in crosses between species with centromeres of different size, and by a CENH3 mutation that affects centromere loading [41,44]. Furthermore, haploid plants were generated in crosses with maize heterozygous for a cenh3 null mutation, suggesting that dilution of CENH3 during gametophytic divisions can render centromeres smaller or dysfunctional [60]. However, the substantially reduced level of CENH3 that, according to the immunocytological data, results in smaller centromeres and impaired mitotic spindles, was not efficient in haploid induction, at least in Arabidopsis cenh3-4 mutants. Notably, a comparably low frequency of Arabidopsis haploids was found after reducing the amount of wild-type CENH3 through female gametogenesis in plants heterozygous for the cenh3-1 null mutation [61]. Also in wheat, multiple knock-outs of homeologous CENH3 genes are insufficient to induce haploid plants unless combined with a hypomorphic mutation containing a short deletion in the CENH3 N-terminal domain [62]. Thus, the efficiency of centromere-mediated genome elimination may depend on the extent and combined effects of qualitative and quantitative changes in centromere structure.

Methods Plant material and growth conditions Arabidopsis thaliana ecotype Columbia (Col-0) and mutant seeds were grown on soil in growth chambers at 21°C at 50–60% humidity under 16 h/8 h light/dark cycles. The following mutant lines were used in this study: smg7-6 [32], smg7-1, smg7-3 [30], gl1-1 derived from tert line [63]. The tdm1-4 mutant was obtained from NASC (SALK_123139) and PCR-genotyped using PCR primers described in S1 Table. Plants used for live cell imaging were generated by introgression of reporter constructs from HTA10:RFP [33] and pRPS5A::TagRFP:TUB4 [22] lines. Root growth assay was performed by growing surface-sterilized seeds on vertically oriented MS agar plates (0.7% plant agar, Duchefa Biochemie) at 21°C under 16 h/8 h light/dark photoperiods. The position of the root tip was marked 5, 8 and 10 days after germination to determine the root growth rate. Assessment of plant fertility Pollen viability was determined by Alexander staining as described [64]. Silique length was measured when apical meristems ceased forming new flowers. Average silique length was calculated at each position for the first 40 siliques along the main inflorescence bolt (numbered with 1 for the oldest and 40 for the youngest silique). Genetic screening Seeds from smg7-6 plants were incubated in 50 ml of water at 4°C overnight. Water was replaced with 50 ml of 0.3% (v/v) ethyl-methanesulfonate (EMS) in water and incubated for 8 h at room temperature in the dark with gentle shaking. The EMS solution was replaced with water and the seeds were incubated for 3 days at 4°C in the dark. Twelve seeds were sown per pot (9x9 cm) and M2 seeds were pooled from all plants in one pot. Around 100 M2 seeds from each pool were grown and manually scored for improved fertility compared to smg7-6 mutants grown in parallel. The genetic transmissibility of restored fertility was confirmed in the M3 generation and M3 plants were backcrossed to the parental smg7-6 line to create B2 mapping populations. Inflorescences from segregants with improved fertility in B2 were pooled (at least 50 plants per line) for DNA extraction using the CTAB (cetyltrimethyl ammonium bromide) method [65]. DNA (2 μg) was sheared in a S220 Focused-ultrasonicator (Covaris), DNA fragments were purified using the DNA Clean &Concentrator-5 kit (Zymo Research), and quantified using the Quant-iT PicoGreen dsDNA Reagent (Thermo Fisher Scientific). After analyzing the samples for proper fragmentation (~150 bp) in an Agilent 2100 Bioanalyser System (Agilent Technologies), DNA libraries were prepared using 300 ng of fragmented DNA following the instructions of the NEBNext Ultra II DNA Library Prep kit (New England Biolabs). Samples were sequenced on a HiSeq 2500 (Illumina) with the sequencing output of single ends with 100 nucleotides in size. Mutations associated with improved fertility were identified using ArtMAP software [34]. For further genetic experiments, the identified cenh3-4 mutation was PCR-genotyped by the Derived Cleaved Amplified Polymorphic Sequences (dCAPS) method using primers described in S1 Table. The PCR product was cleaved with PstI and separated in 2% (w/v) high-resolution agarose in TBE buffer. The amplicon of the wild type allele remained uncleaved with a size of 222 bp, while that of the cenh3-4 allele was cut into 188 bp and 34 bp fragments. Cytology Staining of PMCs in whole anthers was performed as previously described [66] with the following modifications: inflorescences were fixed in PEM buffer (50 mM Pipes pH 6.9, 5 mM EGTA pH 8.0, 5 mM MgSO4, 0.1% Triton X100) supplemented with 4% formaldehyde by 15 min vacuum infiltration and 45 min incubation at room temperature. Inflorescences were washed 3x with PEM buffer and buds smaller than 0.6 mm were dissected, transferred to 100 μl of PEM supplemented with DAPI (5 μg/ml), and stained for 1 h in the dark. Anthers were washed twice with 1 ml of PEM buffer for 5 min, then incubated in PEM buffer at 60°C for 10 min and at 4°C for 10 min. Anthers were washed once, mounted in Vectashield (Vector Laboratories), covered with cover slips, and examined on an LSM700 or LSM880 confocal microscope (Zeiss). Immunodetection of microtubules in pollen mother cells was performed using rat anti-α-tubulin antibody (Serotec) as previously described [29]. The same protocol was applied to detect CENH3 with a custom-made (LifeTein, https://www.lifetein.com) polyclonal antisera raised against the N-terminal peptide of CenH3 [67] and anti-Rabbit-Alexa Fluor 488 (ThermoFisher Scientific). KNL2, MIS12 and CENP-C were detected in root nuclei as previously described [68] using custom made anti-AtKNL2 (dilution 1:2000) [38], anti-MIS12 (1:1000) or anti-AtCENP-C (1:300) antibodies (http://www.eurogentec.com/) [51] and goat anti-rabbit rhodamine (Jackson Immuno Research Laboratories). DNA content in nuclei of haploid plants was determined by flow cytometry as previously described [69]. Live cell imaging Live cell imaging of spindles in PMCs was performed with the pRPS5A::TagRFP:TUB4 marker [22] using a protocol developed for light sheet microscopy [33]. Briefly, the floral buds were embedded in 5MS (5% sucrose + ½ MS, Murashige & Skoog Medium including vitamins and MES buffer, Duchefa Biochemie) supplemented with 1% low gelling agarose (Sigma Aldrich) in a glass capillary (size 4, Brand). The capillary was mounted in the metal holder of the Light sheet Z.1 microscope (Zeiss), the agarose with the embedded floral bud was partially pushed out from the glass capillary into the microscopy chamber containing 5MS media, and imaged in Light sheet Z.1 microscope using 10x objective (Detection optics 10x/0.5), single illumination (Illumination Optics 10x/0.2), 561 nm laser (15% intensity) in 5min time increments. The image data were processed by ZEN Blue software (Zeiss). Live cell imaging of mitosis in roots was performed with the HTA10:RFP marker as follows: surface-sterilized seeds were germinated on 1 ml of ½ MS medium with 0.8% phyto-agar (Duchefa Biochemie) in petri dishes with a glass bottom (MatTek corporation). Once growing roots reached the glass bottom, they were imaged with an LSM780 inverted confocal microscope (Zeiss, 40x objective) in 1 min intervals. Two ml of 2 μM oryzalin solution were added to plates 10 min before imaging. Images were processed using Zen Black (Zeiss). Chromatin immunoprecipitation ChIP experiments were performed from 10 day old seedlings with chromatin sheared to approximately 500 bp fragments by sonication according to a previously described protocol [70]. Five μl of anti-histone H3 antibody (1 mg/ml; ab1791; Abcam), and 10 μl of anti-CENH3 antibody were used. Detection of centromeric 180 bp satellite DNA was performed by dot-blot hybridization as well as by qPCR. For dot-blot hybridization, 40 μl from 50 μl samples were combined with 10 μl of MILI-Q water and 6 μl of 3 M NaOH, incubated for 1 h at 65°C and dot-blotted on Amersham HybondTM-XL membrane (GE Healthcare). DNA was fixed by UV using a UV crosslinker BLX-254 (Analytik Jena). After prehybridization at 65°C for 2 h in hybridization buffer (7% SDS, 0.25 M sodium-phosphate buffer pH 7.2), membranes were hybridized at 65°C overnight with denatured probes generated by Klenow-labeling of an Arabidopsis centromere 180 bp satellite fragment with α32P dATP (DecaLabel DNA Labeling Kit, Thermo Scientific). The fragment was prepared by PCR amplification of Arabidopsis genomic DNA using the primer combination CEN-1 ATCAAGTCATATTCGACTCCA and CEN-2 CTCATGTGTATGATTGAGAT, followed by purification (NucleoSpin Gel and PCR Clean-up, Macherey-Nagel). Membranes were washed twice with 2x SSC, 0.1% SDS at RT for 5 min and twice with 0.2x SSC, 0.1% SDS at 65°C for 15 min. Membranes were wrapped in Saran wrap and exposed to a phospho-screen which was scanned with a Typhoon FLA 7000 (GE Healthcare). Signals were quantified using ImageQuant software (GE Healthcare). For qPCR quantification, 1 μl from 50 μl samples was used in a 20 μl qPCR reaction containing 1x LightCycler 480 High Resolution Melting Master mix, 3 mM MgCl2, and 0.25 μM of each primer CEN-f CCGTATGAGTCTTTGGCTTTG and CEN-r TTGGTTAGTGTTTTGGAGTCG. Reactions were performed in technical triplicates and quantified as percent of input. Western blot analysis For nuclei purification, 300 mg of inflorescences were collected in 15 ml Falcon tubes, frozen in liquid nitrogen, and homogenized with metal beads by vortexing. The disrupted tissue was resuspended in 5 ml of nuclei isolation buffer (NIB) (10 mM MES-KOH pH 5.3, 10 mM NaCl, 10 mM KCl, 250 mM sucrose, 2.5 mM EDTA, 2.5 mM ß-mercaptoethanol, 0.1 mM spermine, 0.1 mM spermidine, 0.3% Triton X-100), and filtered through two layers of Miracloth into a 50 ml Falcon tube. Nuclei were pelleted by centrifugation, resuspended in 1 ml NIB and collected again by centrifugation. The pellet was resuspended in 150 μl of N buffer (250 mM sucrose, 15 mM Tris-HCl pH 7.5, 60 mM KCl, 15 mM NaCl, 5 mM MgCl 2 , 1 mM CaCl 2 , 1 mM DTT, 10 mM ß-glycerophosphate, protease inhibitors). Nuclei were lysed by adding 40 μl 5x Laemmli loading buffer (Sigma) and boiling for 5 min. 40 μg of nuclear protein was separated by SDS-polyacrylamide gel electrophoresis. Separated proteins were transferred to PVDF membranes (Thermo Scientific) by electroblotting. The membranes were incubated in low-fat milk with rabbit anti-CENH3 antibody (1:5,000; ab72001; Abcam) for 12 h at 4°C. Secondary anti-rabid-HPR conjugated antibody was diluted (1:5000) and incubated for 2 h. TBST (25 mM Tris-Cl, pH 7.5, 150 mM NaCl, 0.05% Tween-20, pH 7.5) was used to wash the membranes and the signal was detected using ECL Western Blotting Substrate (Pierce). RNA analysis RNA was isolated from inflorescences using the RNeasy Plant Mini Kit (Qiagen). Samples were treated with TURBO DNA-free Kit (Ambion) to remove contaminants from genomic DNA. cDNA was synthetized from 5 μg of RNA with the Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Scientific) and oligo (dT)18 primer. cDNA was used as a template for quantitative PCR reactions using the FastStart Essential DNA Green Master (Roche) and transcript-specific primer pairs (S1 Table) on the LightCycler 96 System (Roche). The ΔΔCt method was used to calculate the relative quantification of transcripts [71]. MON1 (AT2G28390) was used as reference gene, and transcript levels for each genotype were normalized to wild type controls.

Acknowledgments We thank to Arp Schnittger for providing the pRPS5A::TagRFP:TUB4 line, Sona Valuchova for help with image processing, and Andreas Houben for helpful discussion. The genome sequencing was performed by the Next Generation Sequencing Facility at Vienna BioCenter Core Facilities (VBCF), member of the Vienna BioCenter (VBC), Austria. We also acknowledge the Plant Sciences Facility at Vienna BioCenter Core Facilities (VBCF), and the Plant Sciences Core Facility of CEITEC MU for support with plant cultivation. Microscopy was performed in the BioOptics facility at the IMP, and the core facility CELLIM of CEITEC.

[END]

[1] Url: https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1009779

(C) Plos One. "Accelerating the publication of peer-reviewed science."
Licensed under Creative Commons Attribution (CC BY 4.0)
URL: https://creativecommons.org/licenses/by/4.0/


via Magical.Fish Gopher News Feeds:
gopher://magical.fish/1/feeds/news/plosone/

You are viewing proxied material from magical.fish. The copyright of proxied material belongs to its original authors. Any comments or complaints in relation to proxied material should be directed to the original authors of the content concerned. Please see the disclaimer for more details.