(C) PLOS One [1]. This unaltered content originally appeared in journals.plosone.org.
Licensed under Creative Commons Attribution (CC BY) license.
url:https://journals.plos.org/plosone/s/licenses-and-copyright

------------



Tau, XMAP215/Msps and Eb1 co-operate interdependently to regulate microtubule polymerisation and bundle formation in axons

['Ines Hahn', 'The University Of Manchester', 'Manchester Academic Health Science Centre', 'Faculty Of Biology', 'Medicine', 'Health', 'School Of Biological Sciences', 'Manchester', 'United Kingdom', 'Andre Voelzmann']

Date: 2021-09

The formation and maintenance of microtubules requires their polymerisation, but little is known about how this polymerisation is regulated in cells. Focussing on the essential microtubule bundles in axons of Drosophila and Xenopus neurons, we show that the plus-end scaffold Eb1, the polymerase XMAP215/Msps and the lattice-binder Tau co-operate interdependently to promote microtubule polymerisation and bundle organisation during axon development and maintenance. Eb1 and XMAP215/Msps promote each other’s localisation at polymerising microtubule plus-ends. Tau outcompetes Eb1-binding along microtubule lattices, thus preventing depletion of Eb1 tip pools. The three factors genetically interact and show shared mutant phenotypes: reductions in axon growth, comet sizes, comet numbers and comet velocities, as well as prominent deterioration of parallel microtubule bundles into disorganised curled conformations. This microtubule curling is caused by Eb1 plus-end depletion which impairs spectraplakin-mediated guidance of extending microtubules into parallel bundles. Our demonstration that Eb1, XMAP215/Msps and Tau co-operate during the regulation of microtubule polymerisation and bundle organisation, offers new conceptual explanations for developmental and degenerative axon pathologies.

Axons are the up-to-meter-long processes of nerve cells that form the cables wiring our nervous system. Once established, they must survive for a century in humans. Improper extension of axons leads to neurodevelopmental defects, and age- or disease-related neurodegeneration usually starts in axons. Axonal architecture and function depend on bundles of filamentous polymers, called microtubules. These bundles run all along the axonal core, and their disruption correlates with axon decay. How these axonal microtubule bundles are formed and dynamically maintained is little understood. We bridge this knowledge gap by studying how different classes of microtubule-binding proteins may regulate these processes. Here we show how three proteins of very different function, Eb1, XMAP215 and Tau, cooperate intricately to promote the polymerisation processes that form new microtubules during axon development and maintenance. If either protein is dysfunctional, polymerisation is slowed down and newly forming microtubules fail to align into proper bundles. These findings provide new explanations for the decay of microtubule bundles, hence axons. To unravel these mechanisms, we used the fruit fly as a powerful organism for biomedical discoveries. We then showed that the same mechanisms act in frog axons, suggesting they might apply also to humans.

Funding: This work was made possible through support by the BBSRC to A.P (BB/I002448/1, BB/P020151/1, BB/L000717/1, BB/M007553/1) to N.S.S. (BB/M007456/1, BB/R018960/1), by the Leverhulme Trust to I.H. (ECF-2017-247), by the Deutsche Forschungsgemeinschaft to A.V. (VO 2071/1-1), by NIH to L.A.L (R01 MH109651), and a postdoctoral fellowship from Consejo Nacional de Innovación, Ciencia y Tecnología ( https://www.gob.pe/concytec ) to P.G.S. The Manchester Bioimaging Facility microscopes used in this study were purchased with grants from the BBSRC ( https://bbsrc.ukri.org/ ), The Wellcome Trust ( https://wellcome.org/ ) and The University of Manchester Strategic Fund ( https://www.bmh.manchester.ac.uk/research/support/funding/strategic/ ). The Fly Facility has been supported by funds from The University of Manchester ( https://www.bmh.manchester.ac.uk/research/support/funding/strategic/ ) and the Wellcome Trust (087742/Z/08/Z; AP). Stocks obtained from the Bloomington Drosophila Stock Center (NIH P40OD018537) were used in this study. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Data Availability: The authors confirm that all data underlying the findings (underlying numerical data for all graphs and summary statistics) are fully available without restriction. All relevant data are within the paper and its Supporting information files.

Copyright: © 2021 Hahn et al. This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Here we have incorporated more candidate factors and additional readouts to take these analyses to the next level. We show that three factors, Eb1, XMAP215/Msps and Tau, share a unique combination of mutant phenotypes in culture and in vivo, including reduced axonal MT polymerisation in frog and fly neurons. Our data reveal that the three factors co-operate. Eb1 and XMAP215/Msps act interdependently at MT plus-ends, whereas Tau acts through a novel mechanism: it outcompetes Eb1-binding along MT lattices, thus preventing the depletion of Eb1 pools at polymerising MT plus-ends. By upholding these Eb1 pools, the functional trio also promotes the bundle conformation of axonal MTs through a guidance mechanism mediated by the spectraplakin Shot. Our work uniquely integrates molecular mechanisms into understanding of MT regulation that is biologically relevant for axon growth, maintenance and disease.

To identify relevant factors regulating axonal MT polymerisation, we use Drosophila primary neurons as one consistent model, which is amenable to combinatorial genetics as a powerful strategy to decipher complex regulatory networks [ 19 ]. Our previous loss-of-function studies of 9 MT plus-end-associating factors in these Drosophila neurons (CLASP, CLIP190, dynein heavy chain, APC, p150 Glued , Eb1, Short stop/Shot, doublecortin, Lis1) have taken axon length as a crude proxy readout for net polymerisation, mostly revealing relatively mild axon length phenotypes, with the exception of Eb1 and Shot which cause severe axon shortening [ 20 – 22 ].

MT polymerisation is primarily understood in vitro, where MTs can undergo polymerisation in the presence of nucleation seeds and tubulin heterodimers; the addition of catalytic factors such as CLASPs, stathmins, tau, Eb proteins or XMAP215 can enhance and refine these events [ 10 – 16 ]. However, we do not know whether mechanisms observed in reconstitution assays are biologically relevant in the context of axons [ 7 ], especially when considering that none of the above-mentioned factors has genetic links to human neurological disorders on OMIM (Online Mendelian Inheritance in Man), except Tau/MAPT which features primarily with dominant mutations relating to functions less likely to represent its intrinsic MT-regulatory roles [ 2 , 17 , 18 ].

Their growth and maintenance absolutely require parallel bundles of microtubules (MTs) that run all along axons, providing the highways for life-sustaining transport and driving morphogenetic processes. Consequently, bundle decay through MT loss or disorganisation is a common feature in axon pathologies (summarised in [ 2 , 6 ]). Key roles must be played by MT polymerisation, which is not only essential for the de novo formation of MT bundles occurring during axon growth in development, plasticity or regeneration, but also to repair damaged and replace senescent MTs during long-term maintenance [ 7 – 9 ]. However, the molecular mechanisms regulating MT polymerisation in axons are surprisingly little understood.

Axons are the enormously long cable-like cellular processes of neurons that wire nervous systems. In humans, axons of ≤15μm diameter can be up to two meters long [ 1 , 2 ]. They are constantly exposed to mechanical challenges, yet have to survive for up to a century; we lose ~40% of axons towards high age and far more in neurodegenerative diseases [ 3 – 5 ].

For protein extraction, 10 embryos were transferred to a centrifuge tube with 800 μl lysis buffer (50 mM Tris pH 7.5, 5% glycerol, 0.2% IGEPAL/NP-40, 1 mM EDTA, 1.5 mM MgCl 2 , 125 mM NaCl, 25 mM NaF, 1 mM Na 3 VO 4 ), homogenised with a sterile pestle and, after 10 mins, centrifuged at 13,000 rpm for 15–20 min. The supernatant was collected and the protein concentration determined with the Micro BCA Protein Assay Kit (Thermo Fisher Scientific). 80 μg protein were loaded into a 10% SDS gel and stained with anti-Tau (clone Tau46, T9450, mouse, 1:1000, Sigma-Aldrich).

Images were derived from at least 3 independent experimental repeats performed on different days, for each of which at least 2 independent culture wells were analysed by taking a minimum of 20 images per slide. For statistical analyses, Kruskal–Wallis one-way ANOVA with post hoc Dunn’s test or Mann–Whitney Rank Sum Tests (indicated as P MW ) were used to compare groups, r and p-value for correlation were determined via non-parametric Spearman correlation analysis (tests showed that data are not distributed normally). All raw data of our analyses are provided ( S1 – S14 Data).

To assess EB1 comet dynamics and comet amounts in Xenopus neurons, 300 pg of MACF43-Ctail::GFP (an Eb protein-binding 43-residue fragment derived from the C-terminal regions of hMACF2/human microtubule actin crosslinking factor 2; Fig 3F-3F”‘; [ 55 , 56 ]), was co-injected with the MO. Time lapse imaging of Xenopus primary cultures was performed with a CSU-X1M 5000 spinning-disk confocal (Yokogawa, Tokyo, Japan) on a Zeiss Axio Observer inverted motorized microscope with a Zeiss 63× Plan Apo 1.4 numerical aperture lens (Zeiss, Thornwood, NY). Images were acquired with an ORCA R2 charge-coupled device camera (Hamamatsu, Hamamatsu, Japan) controlled with Zen software. Time lapse movies were constructed from images taken at 2 s intervals for 1 min. MACF43 comet velocity and lifetime were analysed with plusTipTracker software. The same parameters were used for all movies: maximum gap length, eight frames; minimum track length, three frames; search radius range, 5–12 pixels; maximum forward angle, 50°; maximum backward angle, 10°; maximum shrinkage factor, 0.8; fluctuation radius, 2.5 pixels; and time interval 2 s.

To measure MT polymerisation dynamics in Drosophila neurons [ 54 ], movies were collected on an Andor Dragonfly200 spinning disk upright confocal microscope (with a Leica DM6 FS microscope frame) and using a 100x/1.40 UPlan SAPO (Oil) objective. Samples where excited using 488 nm (100%) and 561 nm (100%) diode lasers via Leica GFP and RFP filters respectively. Images where collected using a Zyla 4.2 Plus sCMOS camera with a camera gain of 1x. The incubation temperature was set to 26°C. Time lapse movies were constructed from images taken at 1 s intervals for 1 min. To measure comet velocity and lifetime, a line was drawn that followed the axon using the segmented line tool in Fiji/ImageJ. A kymograph was then constructed from average intensity in Fiji using the KymoResliceWide macro (Cell Biology group, Utrecht University) and events scored via the Velocity Measurement Tool Macro (Volker Baecker, INSERM, Montpellier, RIO Imaging; J. Rietdorf, FMI Basel; A. Seitz, EMBL Heidelberg). For each condition at least 15 cells were analysed in ≥2 independent repeats.

To measure MT curling in the optic lobe of adult flies, GMR31F10-Gal4 (Bloomington #49685) was used to express UAS-α-tubulin84B-GFP [ 39 ] in a subset of lamina axons which project within well-ordered medulla columns [ 53 ]. Flies were left to age for 26–27 days (about half their life expectancy) and then their brains were dissected as explained above and immediately imaged with a 3i Marianas Spinning Disk Confocal Microscope at the ITM Biomedical imaging facility at the University of Liverpool. A section of the medulla columns comprising the 4 most proximal axonal terminals was used to quantify the number of swellings and regions with disorganised curled MTs.

Eb1 comet amounts were approximated by using the product of comet mean intensity and length. For this, a line was drawn through each comet (using the segmented line tool in Fiji) to determine length as well as mean staining intensity of Eb1 or GTP-tub in fixed Drosophila and MACF43::GFP in movie stills of Xenopus neurons.

Degree of disorganised MT curling in axons was measured as "MT disorganisation index" (MDI) described previously [ 37 , 41 ]; in short: the area of disorganised curling was measured with the freehand selection in ImageJ; this value was then divided by axon length (see above) multiplied by 0.5 μm (typical axon diameter, thus approximating the expected area of the axon if it were properly bundled).

Standard imaging was performed with AxioCam 506 monochrome (Carl Zeiss Ltd.) or MatrixVision mvBlueFox3-M2 2124G digital cameras mounted on BX50WI or BX51 Olympus compound fluorescent microscopes. For the analysis of Drosophila and Xenopus primary neurons, we used the following parameters:

Primary fly or frog neurons were fixed in 4% paraformaldehyde (PFA; in 0.05 M phosphate buffer, pH 7–7.2) for 30 min at room temperature (RT). For anti-Eb1 and anti-GTP-tubulin staining, cells were fixed for 10 mins at -20°C in +TIP fix (90% methanol, 3% formaldehyde, 5 mM sodium carbonate, pH 9; stored at -80°C and added to the cells [ 49 ]), then washed in PBT (PBS with 0.3% TritonX). Antibody staining and washes were performed with PBT. Staining reagents: anti-tubulin (clone DM1A, mouse, 1:1000, Sigma; alternatively, clone YL1/2, rat, 1:500, Millipore Bioscience Research Reagents); anti-DmEb1 (gift from H. Ohkura; rabbit, 1:2000; [ 28 ]); anti-GTP-tubulin (hMB11; human, 1:200; AdipoGen; [ 50 ]); anti-Shot (1:200, guinea pig; [ 51 ]); anti-Elav (Elav-7E8A10; rat, 1:1000; Developmental Studies Hybridoma Bank, The University of Iowa, IA, USA; [ 52 ]); anti-GFP (ab290, Abcam, 1:500); Cy3-conjugated anti-HRP (goat, 1:100, Jackson ImmunoResearch); F-actin was stained using phalloidin conjugated with TRITC/Alexa647, FITC or Atto647N (1:100 or 1:500; Invitrogen and Sigma). Specimens were embedded in ProLong Gold Antifade Mountant (ThermoFisher Scientific).

For in vivo studies, brain dissections were performed in Dulbecco’s PBS (Sigma, RNBF2227) after briefly sedating them on ice. Dissected brains with their laminas and eyes attached were placed into a drop of Dulbecco’s PBS on MatTek glass bottom dishes (P35G1.5-14C), covered by coverslips and immediately imaged.

The embryos were injected four times in dorsal blastomeres at two-to-four cell stage with 6 ng of the validated XMAP215 morpholino (MO; [ 47 ]), 10 ng of the validated tau MO [ 48 ], and/or 5 ng of a newly designed splice site MO for EB3 (3´CTCCCAATTGTCACCTACTTTGTCG5´; for verification see S5 Fig ), in order to obtain a 50% knockdown of each.

All experiments were approved by the Boston College Institutional Animal Care and Use Committee and performed according to national regulatory standards. Xenopus primary neuron cultures were obtained from embryonic neural tubes. Eggs collected from female X. laevis frogs were fertilised in vitro, dejellied and cultured following standard methods [ 44 ]. Embryos were grown to stage 22–24 [ 45 ], and neural tubes were dissected as described [ 46 ]. Three neural tubes were transferred for 10 minutes to an Eppendorf tube containing 150 μl CMF-MMR (0.1 M NaCl, 2.0 mM KCl, 1.0 mM EDTA, 5.0 mM HEPES, pH 7.4), centrifuged at 1000 g for 5 min, and 150 μl of Steinberg’s solution [58 mM NaCl, 0.67 mM KCl, 0.44 mM Ca(NO 3 ) 2 , 1.3 mM MgSO 4 , 4.6 mM Tris, pH 7.8] was added to the supernatant to follow with the tissue dissociation using a fire-polished glass Pasteur pipet. Cells were seeded on 60 mm plates pre-treated with 100 μg/ml poly-L-lysine and 10 μg/ml laminin; after 2 hrs the medium was replaced by plating culture medium (50% Ringer’s, 49% L-15 medium, 1% fetal bovine serum, 25 ng/μl NT3 and BDNF, plus 50 μg/ml penicillin/streptomycin and gentamycin, pH 7.4 and filter-sterilized) and kept for 24 hr before imaging.

Transfection of Drosophila primary neurons was executed as described previously [ 37 ]. In brief, 70–75 embryos per 100 μl dispersion medium were used. After the washing step and centrifugation, cells were re-suspended in 100 μl transfection medium [final media containing 0.1–0.5 μg DNA and 2 μl Lipofecatmine 2000 (L2000, Invitrogen)], incubated following manufacturer’s protocols (Thermo Fisher, Invitrogen) and kept for 24 hrs at 26°C. Cells were then treated again with dispersion medium, re-suspended in culture medium and plated out as described above.

For larval cultures, brains from third instar larvae were dissected in PBS (2–3 per cover slip), transferred into Schneider’s/FCS medium, washed three times with medium and then processed via homogenisation and dispersion as explained above.

To eliminate a potential maternal rescue of mutants (i.e. reduction of the mutant phenotype due to normal gene product deposition from the wild-type gene copy of the heterozygous mothers in oocytes [ 42 ], we used a pre-culture strategy [ 40 , 43 ] where cells were incubated in a tube for 5–7 days before they were plated on coverslips.

Drosophila primary neuron cultures were done as described previously [ 40 , 41 ]. Stage 11 embryos were treated for 90 s with bleach to remove the chorion, sterilized for ~30 s in 70% ethanol, washed in sterile Schneider’s medium containing 20% fetal calf serum (Schneider’s/FCS; Gibco), and eventually homogenized with micro-pestles in 1.5 ml centrifuge tubes containing 21 embryos per 100 μl dispersion medium [ 40 ] and left to incubate for 4 min at 37°C. Dispersion was stopped with 200 μl Schneider’s/FCS, cells were spun down for 4 mins at 650 g, supernatant was removed and cells re-suspended in 90 μl of Schneider’s/FCS; 30 μl drops were placed in culture chambers and covered with cover slips. Cells were allowed to adhere to cover slips for 90–120 min either directly on glass or on cover slips coated with a 5 μg/ml solution of concanavalin A, and then grown as a hanging drop culture at 26°C as indicated.

Loss-of-function mutant stocks used in this study were the deficiencies Df(3R)Antp17 (tub def ; removing both αtub84B and αtub84D; [ 23 , 24 ]), Df(2L)Exel6015 (stai Df ; [ 25 ], Df(3L)BSC553 (clasp Df ; Bloomington stock #25116; [ 20 ]), Df(3R)tauMR22 (tau Df ; [ 26 ]) and the loss-of-function mutant alleles α-tub84B KO (an engineered null-allele; [ 24 ]), chromosome bows 2 (clasp 2 , an amorph allele; [ 27 ]), Eb1 04524 and Eb1 5 (two strong loss-of-function mutant alleles; [ 28 ]), futsch P158 (MAP1B - ; a deficiency uncovering the futsch locus; [ 29 ]), msps A (a small deletion causing a premature stop after 370 amino acids; gift from H. Ohkura), msps 146 [ 30 ], sentin ΔB short spindle2 ΔB , (ssp2 ΔB ; [ 31 ]), tacc 1 (dTACC 1 ; [ 32 ]), shot 3 (the strongest available allele of short stop; [ 21 , 33 ]), stai KO [ 34 ], tau KO (a null allele; [ 35 ]. Gal4 driver lines used were elav-Gal4 (1 st and 3 rd chromosomal, both expressing pan-neuronally at all stages; [ 36 ]), GMR31F10-Gal4 (Bloomington #49685; expressing in T1 medulla neurons; [ 37 ]). Lines for targeted gene expression were UAS-Eb1-GFP and UAS-shot-Ctail-GFP [ 22 ], UAS-shot ΔABD -GFP [ 38 ], UAS-shot 3MTLS* -GFP [ 22 ], UAS-dtau-GFP [ 26 ], UAS-GFP-α-tubulin84B [ 39 ] and further lines generated here (see below).

Results

[END]

[1] Url: https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1009647

(C) Plos One. "Accelerating the publication of peer-reviewed science."
Licensed under Creative Commons Attribution (CC BY 4.0)
URL: https://creativecommons.org/licenses/by/4.0/


via Magical.Fish Gopher News Feeds:
gopher://magical.fish/1/feeds/news/plosone/

You are viewing proxied material from magical.fish. The copyright of proxied material belongs to its original authors. Any comments or complaints in relation to proxied material should be directed to the original authors of the content concerned. Please see the disclaimer for more details.