NAME

   Bio::WebService::LANL::SequenceLocator - Locate sequences within HIV
   using LANL's web tool

SYNOPSIS

       use Bio::WebService::LANL::SequenceLocator;

       my $locator = Bio::WebService::LANL::SequenceLocator->new(
           agent_string => 'Your Organization - [email protected]',
       );
       my @sequences = $locator->find([
           "agcaatcagatggtcagccaaaattgccctatagtgcagaacatccaggggcaagtggtacatcaggccatatcacctagaactttaaatgca",
       ]);

   See "EXAMPLE RESULTS" below.

DESCRIPTION

   This library provides simple programmatic access to LANL's HIV sequence
   locator <http://www.hiv.lanl.gov/content/sequence/LOCATE/locate.html>
   web tool and is also used to power a simple, JSON-based web API
   <https://indra.mullins.microbiol.washington.edu/locate-sequence/> for
   the same tool (via Bio::WebService::LANL::SequenceLocator::Server).

   Nearly all of the information output by LANL's sequence locator is
   parsed and provided by this library, though the results do vary
   slightly depending on the base type of the query sequence. Multiple
   query sequences can be located at the same time and results will be
   returned for all.

   Results are extracted from both tab-delimited files provided by LANL as
   well as the HTML itself.

EXAMPLE RESULTS

       # Using @sequences from the SYNOPSIS above
       use JSON;
       print encode_json(\@sequences);

       __END__
       [
          {
             "query" : "sequence_1",
             "query_sequence" : "AGCAATCAGATGGTCAGCCAAAATTGCCCTATAGTGCAGAACATCCAGGGGCAAGTGGTACATCAGGCCATATCACCTAGAACTTTAAATGCA",
             "base_type" : "nucleotide",
             "reverse_complement" : "0",
             "alignment" : "\n Query AGCAATCAGA TGGTCAGCCA AAATTGCCCT ATAGTGCAGA ACATCCAGGG  50\n       ::::::::    ::::::::: ::::: :::: :::::::::: :::::::::: \n  HXB2 AGCAATCA-- -GGTCAGCCA AAATTACCCT ATAGTGCAGA ACATCCAGGG  1208\n\n Query GCAAGTGGTA CATCAGGCCA TATCACCTAG AACTTTAAAT GCA  93\n       :::: ::::: :::::::::: :::::::::: :::::::::: ::: \n  HXB2 GCAAATGGTA CATCAGGCCA TATCACCTAG AACTTTAAAT GCA  1251\n\n  ",
             "hxb2_sequence" : "AGCAATCA---GGTCAGCCAAAATTACCCTATAGTGCAGAACATCCAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCA",
             "similarity_to_hxb2" : "94.6",
             "start" : "373",
             "end" : "462",
             "genome_start" : "1162",
             "genome_end" : "1251",
             "polyprotein" : "Gag",
             "region_names" : [
                "Gag",
                "p17",
                "p24"
             ],
             "regions" : [
                {
                   "cds" : "Gag",
                   "aa_from_protein_start" : [ "125", "154" ],
                   "na_from_cds_start" : [ "373", "462" ],
                   "na_from_hxb2_start" : [ "1162", "1251" ],
                   "na_from_query_start" : [ "1", "93" ],
                   "protein_translation" : "SNQMVSQNCPIVQNIQGQVVHQAISPRTLNA"
                },
                {
                   "cds" : "p17",
                   "aa_from_protein_start" : [ "125", "132" ],
                   "na_from_cds_start" : [ "373", "396" ],
                   "na_from_hxb2_start" : [ "1162", "1185" ],
                   "na_from_query_start" : [ "1", "27" ],
                   "protein_translation" : "SNQMVSQNC"
                },
                {
                   "cds" : "p24",
                   "aa_from_protein_start" : [ "1", "22" ],
                   "na_from_cds_start" : [ "1", "66" ],
                   "na_from_hxb2_start" : [ "1186", "1251" ],
                   "na_from_query_start" : [ "28", "93" ],
                   "protein_translation" : "PIVQNIQGQVVHQAISPRTLNA"
                }
             ]
          }
       ]

METHODS

new

   Returns a new instance of this class. An optional parameter
   agent_string should be provided to identify yourself to LANL out of
   politeness. See the "SYNOPSIS" for an example.

find

   Takes an array ref of sequence strings. Sequences may be in amino acids
   or nucleotides and mixed freely. Sequences should not be in FASTA
   format.

   If sequence bases are not clearly nucleotides or clearly amino acids,
   LANL seems to default to nucleotides. This can be an issue for some
   sequences since the full alphabet for nucleotides overlaps with the
   alphabet for amino acids. To overcome this problem, you may specify
   base => 'nucleotide' or base => 'amino acid' after the array ref of
   sequences. This forces every sequence to be interpreted as nucleotides
   or amino acids, so you cannot mix base types in your sequences if you
   use this option. n, nuc, and nucleotides are accepted aliases for
   nucleotide. a, aa, amino, and amino acids are accepted aliases for
   amino acid.

   Returns a list of hashrefs when called in list context, otherwise
   returns an arrayref of hashrefs.

   See "EXAMPLE RESULTS" for the structure of the data returned.

AUTHOR

   Thomas Sibley <[email protected]>

COPYRIGHT

   Copyright 2014 by the Mullins Lab, Department of Microbiology,
   University of Washington.

LICENSE

   Licensed under the same terms as Perl 5 itself.

You are viewing proxied material from ftp.icm.edu.pl. The copyright of proxied material belongs to its original authors. Any comments or complaints in relation to proxied material should be directed to the original authors of the content concerned. Please see the disclaimer for more details.