NAME
Bio::WebService::LANL::SequenceLocator - Locate sequences within HIV
using LANL's web tool
SYNOPSIS
use Bio::WebService::LANL::SequenceLocator;
my $locator = Bio::WebService::LANL::SequenceLocator->new(
agent_string => 'Your Organization -
[email protected]',
);
my @sequences = $locator->find([
"agcaatcagatggtcagccaaaattgccctatagtgcagaacatccaggggcaagtggtacatcaggccatatcacctagaactttaaatgca",
]);
See "EXAMPLE RESULTS" below.
DESCRIPTION
This library provides simple programmatic access to LANL's HIV sequence
locator <
http://www.hiv.lanl.gov/content/sequence/LOCATE/locate.html>
web tool and is also used to power a simple, JSON-based web API
<
http://indra.mullins.microbiol.washington.edu/locate-sequence/> for the
same tool (via Bio::WebService::LANL::SequenceLocator::Server).
Nearly all of the information output by LANL's sequence locator is
parsed and provided by this library, though the results do vary slightly
depending on the base type of the query sequence. Multiple query
sequences can be located at the same time and results will be returned
for all.
Results are extracted from both tab-delimited files provided by LANL as
well as the HTML itself.
EXAMPLE RESULTS
# Using @sequences from the SYNOPSIS above
use JSON;
print encode_json(\@sequences);
__END__
[
{
"query" : "sequence_1",
"query_sequence" : "AGCAATCAGATGGTCAGCCAAAATTGCCCTATAGTGCAGAACATCCAGGGGCAAGTGGTACATCAGGCCATATCACCTAGAACTTTAAATGCA",
"base_type" : "nucleotide",
"reverse_complement" : "0",
"alignment" : "\n Query AGCAATCAGA TGGTCAGCCA AAATTGCCCT ATAGTGCAGA ACATCCAGGG 50\n :::::::: ::::::::: ::::: :::: :::::::::: :::::::::: \n HXB2 AGCAATCA-- -GGTCAGCCA AAATTACCCT ATAGTGCAGA ACATCCAGGG 1208\n\n Query GCAAGTGGTA CATCAGGCCA TATCACCTAG AACTTTAAAT GCA 93\n :::: ::::: :::::::::: :::::::::: :::::::::: ::: \n HXB2 GCAAATGGTA CATCAGGCCA TATCACCTAG AACTTTAAAT GCA 1251\n\n ",
"hxb2_sequence" : "AGCAATCA---GGTCAGCCAAAATTACCCTATAGTGCAGAACATCCAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCA",
"similarity_to_hxb2" : "94.6",
"start" : "373",
"end" : "462",
"genome_start" : "1162",
"genome_end" : "1251",
"polyprotein" : "Gag",
"region_names" : [
"Gag",
"p17",
"p24"
],
"regions" : [
{
"cds" : "Gag",
"aa_from_protein_start" : [ "125", "154" ],
"na_from_cds_start" : [ "373", "462" ],
"na_from_hxb2_start" : [ "1162", "1251" ],
"na_from_query_start" : [ "1", "93" ],
"protein_translation" : "SNQMVSQNCPIVQNIQGQVVHQAISPRTLNA"
},
{
"cds" : "p17",
"aa_from_protein_start" : [ "125", "132" ],
"na_from_cds_start" : [ "373", "396" ],
"na_from_hxb2_start" : [ "1162", "1185" ],
"na_from_query_start" : [ "1", "27" ],
"protein_translation" : "SNQMVSQNC"
},
{
"cds" : "p24",
"aa_from_protein_start" : [ "1", "22" ],
"na_from_cds_start" : [ "1", "66" ],
"na_from_hxb2_start" : [ "1186", "1251" ],
"na_from_query_start" : [ "28", "93" ],
"protein_translation" : "PIVQNIQGQVVHQAISPRTLNA"
}
]
}
]
METHODS
new
Returns a new instance of this class. An optional parameter
"agent_string" should be provided to identify yourself to LANL out of
politeness. See the "SYNOPSIS" for an example.
find
Takes an array ref of sequence strings. Sequences may be in amino acids
or nucleotides and mixed freely. Sequences should not be in FASTA
format.
If sequence bases are not clearly nucleotides or clearly amino acids,
LANL seems to default to nucleotides. This can be an issue for some
sequences since the full alphabet for nucleotides overlaps with the
alphabet for amino acids. To overcome this problem, you may specify
"base => 'nucleotide'" or "base => 'amino acid'" after the array ref of
sequences. This forces every sequence to be interpreted as nucleotides
or amino acids, so you cannot mix base types in your sequences if you
use this option. "n", "nuc", and "nucleotides" are accepted aliases for
"nucleotide". "a", "aa", "amino", and "amino acids" are accepted aliases
for "amino acid".
Returns a list of hashrefs when called in list context, otherwise
returns an arrayref of hashrefs.
See "EXAMPLE RESULTS" for the structure of the data returned.
AUTHOR
Thomas Sibley <
[email protected]>
COPYRIGHT
Copyright 2014 by the Mullins Lab, Department of Microbiology,
University of Washington.
LICENSE
Licensed under the same terms as Perl 5 itself.