NAME
   Bio::WebService::LANL::SequenceLocator - Locate sequences within HIV
   using LANL's web tool

SYNOPSIS
       use Bio::WebService::LANL::SequenceLocator;

       my $locator = Bio::WebService::LANL::SequenceLocator->new(
           agent_string => 'Your Organization - [email protected]',
       );
       my @sequences = $locator->find([
           "agcaatcagatggtcagccaaaattgccctatagtgcagaacatccaggggcaagtggtacatcaggccatatcacctagaactttaaatgca",
       ]);

   See "EXAMPLE RESULTS" below.

DESCRIPTION
   This library provides simple programmatic access to LANL's HIV sequence
   locator <http://www.hiv.lanl.gov/content/sequence/LOCATE/locate.html>
   web tool and is also used to power a simple, JSON-based web API
   <http://indra.mullins.microbiol.washington.edu/locate-sequence/> for the
   same tool (via Bio::WebService::LANL::SequenceLocator::Server).

   Nearly all of the information output by LANL's sequence locator is
   parsed and provided by this library, though the results do vary slightly
   depending on the base type of the query sequence. Multiple query
   sequences can be located at the same time and results will be returned
   for all.

   Results are extracted from both tab-delimited files provided by LANL as
   well as the HTML itself.

EXAMPLE RESULTS
       # Using @sequences from the SYNOPSIS above
       use JSON;
       print encode_json(\@sequences);

       __END__
       [
          {
             "query" : "sequence_1",
             "query_sequence" : "AGCAATCAGATGGTCAGCCAAAATTGCCCTATAGTGCAGAACATCCAGGGGCAAGTGGTACATCAGGCCATATCACCTAGAACTTTAAATGCA",
             "base_type" : "nucleotide",
             "reverse_complement" : "0",
             "alignment" : "\n Query AGCAATCAGA TGGTCAGCCA AAATTGCCCT ATAGTGCAGA ACATCCAGGG  50\n       ::::::::    ::::::::: ::::: :::: :::::::::: :::::::::: \n  HXB2 AGCAATCA-- -GGTCAGCCA AAATTACCCT ATAGTGCAGA ACATCCAGGG  1208\n\n Query GCAAGTGGTA CATCAGGCCA TATCACCTAG AACTTTAAAT GCA  93\n       :::: ::::: :::::::::: :::::::::: :::::::::: ::: \n  HXB2 GCAAATGGTA CATCAGGCCA TATCACCTAG AACTTTAAAT GCA  1251\n\n  ",
             "hxb2_sequence" : "AGCAATCA---GGTCAGCCAAAATTACCCTATAGTGCAGAACATCCAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCA",
             "similarity_to_hxb2" : "94.6",
             "start" : "373"
             "end" : "462",
             "genome_start" : "1162",
             "genome_end" : "1251",
             "polyprotein" : "Gag",
             "region_names" : [
                "Gag",
                "p17",
                "p24"
             ],
             "regions" : [
                {
                   "cds" : "Gag",
                   "aa_from_protein_start" : [ "125", "154" ],
                   "na_from_cds_start" : [ "373", "462" ],
                   "na_from_hxb2_start" : [ "1162", "1251" ],
                   "na_from_query_start" : [ "1", "93" ],
                   "protein_translation" : "SNQMVSQNCPIVQNIQGQVVHQAISPRTLNA"
                },
                {
                   "cds" : "p17",
                   "aa_from_protein_start" : [ "125", "132" ],
                   "na_from_cds_start" : [ "373", "396" ],
                   "na_from_hxb2_start" : [ "1162", "1185" ],
                   "na_from_query_start" : [ "1", "27" ],
                   "protein_translation" : "SNQMVSQNC"
                },
                {
                   "cds" : "p24",
                   "aa_from_protein_start" : [ "1", "22" ],
                   "na_from_cds_start" : [ "1", "66" ],
                   "na_from_hxb2_start" : [ "1186", "1251" ],
                   "na_from_query_start" : [ "28", "93" ],
                   "protein_translation" : "PIVQNIQGQVVHQAISPRTLNA"
                }
             ],
          }
       ]

METHODS
 new
   Returns a new instance of this class. An optional parameter
   "agent_string" should be provided to identify yourself to LANL out of
   politeness. See the "SYNOPSIS" for an example.

 find
   Takes an array ref of sequence strings. Sequences may be in amino acids
   or nucleotides and mixed freely. Sequences should not be in FASTA
   format.

   Returns a list of hashrefs when called in list context, otherwise
   returns an arrayref of hashrefs.

   See "EXAMPLE RESULTS" for the structure of the data returned.

AUTHOR
   Thomas Sibley <[email protected]>

COPYRIGHT
   Copyright 2014 by the Mullins Lab, Department of Microbiology,
   University of Washington.

LICENSE
   Licensed under the same terms as Perl 5 itself.